Difference between revisions of "20.109(S22):Class data"
From Course Wiki
Becky Meyer (Talk | contribs) (→T/R) |
Becky Meyer (Talk | contribs) |
||
(102 intermediate revisions by 29 users not shown) | |||
Line 5: | Line 5: | ||
==Module 1: Drug discovery== | ==Module 1: Drug discovery== | ||
+ | |||
+ | ===SDS-PAGE gel images=== | ||
+ | [[https://www.dropbox.com/sh/1ggz8bk56diszpr/AAAFQLjMEgJcwdjrLg6jtRE5a?dl=0 SDS-PAGE dropbox folder]] | ||
===small molecule selections=== | ===small molecule selections=== | ||
Line 19: | Line 22: | ||
|'''83079118''' | |'''83079118''' | ||
| 69269200 | | 69269200 | ||
− | | | + | | https://www.dropbox.com/s/7eut5ymxmiel9rp/TR_teal_red.xlsx?dl=0 |
|- | |- | ||
| TR Orange | | TR Orange | ||
|'''95877382''' | |'''95877382''' | ||
| 83023303 | | 83023303 | ||
− | | | + | |https://docs.google.com/spreadsheets/d/1Lr5QAYY-63bOfrxuzZh1hgpHfTkCcTuU/edit?usp=sharing&ouid=103020115084669070409&rtpof=true&sd=true |
|- | |- | ||
| TR Yellow | | TR Yellow | ||
− | + | |'''69269200''' | |
− | |''' | + | |83079118 |
− | | | + | |https://www.dropbox.com/s/ssc6b9kp7h6s7zj/20.109%20T%3AR%20Yellow%20Team%20Aggregation%20Assay%20-%20Class%20Data.xlsx?dl=0 |
|- | |- | ||
| TR Green | | TR Green | ||
|69269200 | |69269200 | ||
|'''83079118''' | |'''83079118''' | ||
− | | | + | |https://www.dropbox.com/s/fzo02lfzgo5ujwk/20109_TR_Green_Aggregation_Assay_Data.pptx?dl=0 |
|- | |- | ||
| TR Blue | | TR Blue | ||
|69269200 | |69269200 | ||
|'''83079118''' | |'''83079118''' | ||
− | | | + | |https://www.dropbox.com/s/ezfjb4xt84xv59e/TR_blue.xlsx?dl=0 |
|- | |- | ||
| TR Teal | | TR Teal | ||
|69269200 | |69269200 | ||
|'''83079118''' | |'''83079118''' | ||
− | | | + | |https://www.dropbox.com/scl/fi/1cs77ilahj51l51cw0j2g/TR_Teal_83079119.xlsx?dl=0&rlkey=8l1cae481k6p7p5y8290e8pu2 |
|- | |- | ||
| TR Pink | | TR Pink | ||
Line 54: | Line 57: | ||
|'''69269200''' | |'''69269200''' | ||
| 83079118 | | 83079118 | ||
− | | | + | |https://www.dropbox.com/s/lsdcuxv3y863k3z/TR_purple%20aggregation%20results.xlsx?dl=0 |
|- | |- | ||
| TR Grey | | TR Grey | ||
|'''69269200''' | |'''69269200''' | ||
|83079118 | |83079118 | ||
− | | | + | |https://docs.google.com/spreadsheets/d/12ZOkOtndcb5FXAd1vvHBD4weM_FrWICbkfcykoFhrGY/edit?usp=sharing |
|- | |- | ||
| TR White | | TR White | ||
|'''69269200''' | |'''69269200''' | ||
|83079118 | |83079118 | ||
− | | | + | |https://www.dropbox.com/scl/fi/8x98j2r2nfq2qgwr4eura/White-Team-Aggregation-Results.xlsx?dl=0&rlkey=varbpxlx0apo8b2zkdt4kbxev |
|} | |} | ||
Line 76: | Line 79: | ||
|- | |- | ||
| WF Red | | WF Red | ||
− | | 69269200 | + | |'''69269200''' |
| 83079118 | | 83079118 | ||
+ | |https://mitprod-my.sharepoint.com/:x:/g/personal/mrowlett_mit_edu/EXXtvBLjG9BLtZajiE1PqbUBBkSUVd5xolqzA2KO1u1ADg?e=JjooPh | ||
| | | | ||
|- | |- | ||
| WF Orange | | WF Orange | ||
− | | 83079118 | + | |'''83079118''' |
| 69269200 | | 69269200 | ||
− | | | + | |https://www.dropbox.com/s/8ksmmtml3e673m5/WFOrange%20Aggregation%20Assay%20Data.xlsx?dl=0 |
|- | |- | ||
| WF Yellow | | WF Yellow | ||
− | | 83079118 | + | |'''83079118''' |
| 69269200 | | 69269200 | ||
− | | | + | |https://www.dropbox.com/scl/fi/cotyaashmbv0vrz7wfral/Aggregation-Analysis.xlsx?dl=0&rlkey=r3r8isia4mk6vmy29a5usdykq |
|- | |- | ||
| WF Green | | WF Green | ||
|83079118 | |83079118 | ||
− | |83023303 | + | |'''83023303''' |
− | | | + | |https://www.dropbox.com/s/u38arbolq8zn3xq/20220218_agg_assay_yellow_green%202.xlsx?dl=0 |
|- | |- | ||
| WF Blue | | WF Blue | ||
− | | 69269200 | + | |69269200 |
− | | 83079118 | + | |'''83079118''' |
− | | | + | |https://www.dropbox.com/scl/fi/zogoszln7ydo10em8b196/20220218_agg_assay_blue-83079118.xlsx?dl=0&rlkey=glixenu1uqfo6xa5t1fmvmi08 |
|- | |- | ||
| WF Pink | | WF Pink | ||
| 83079118 | | 83079118 | ||
− | | 69269200 | + | |'''69269200''' |
− | | | + | |https://docs.google.com/spreadsheets/d/13URd1atEq8Aqa6Ur_RrGyESe3g_RDVHK/edit?usp=sharing&ouid=107012858600740729039&rtpof=true&sd=true |
|- | |- | ||
| WF Purple | | WF Purple | ||
− | | 69269200 | + | |'''69269200''' |
| 83079118 | | 83079118 | ||
− | | | + | |https://docs.google.com/spreadsheets/d/1WXBr83b12vb83pYv1bqTUPl5VGFIDap9uOjESwOH0tQ/edit?usp=sharing |
|- | |- | ||
| WF White | | WF White | ||
| 69269200 | | 69269200 | ||
− | | 83023303 | + | |'''83023303''' |
+ | |https://www.dropbox.com/s/c2g5513td5fepee/Aggregation%20Data.xlsx?dl=0 | ||
| | | | ||
|} | |} | ||
+ | |||
+ | ===Aggregation Results=== | ||
+ | |||
+ | [[https://www.dropbox.com/sh/7t091pt8o3zmuwm/AAATFn75fbAZYAUBL0_NOeILa?dl=0 T/R Aggregation dropbox folder]] | ||
+ | |||
+ | |||
+ | ===Localization Results=== | ||
+ | |||
+ | [[https://www.dropbox.com/sh/3hlgp9wuaffzzan/AACxwnjXGWjixOb4pt5x3m6wa?dl=0 Localization Dropbox folder]] | ||
==Module 2: Metabolic engineering== | ==Module 2: Metabolic engineering== | ||
+ | |||
+ | ===Diagnostic Digest gels=== | ||
+ | |||
+ | [[https://www.dropbox.com/sh/mjbmi36a644vj2r/AADvWZHEhzAf6wewHWG3MIIga?dl=0 T/R diagnostic digest folder ]] | ||
+ | <br> | ||
+ | [[https://www.dropbox.com/sh/yha069myv9o4vez/AADLNuCzilifSufHWlmqjb-ga?dl=0 W/F Diagnostic Digest Folder]] | ||
===sgRNA_target sequences=== | ===sgRNA_target sequences=== | ||
Line 132: | Line 152: | ||
|- | |- | ||
| TR Red | | TR Red | ||
− | | | + | | Acetate (A) |
− | | | + | | aceE |
− | | | + | | gagtttcgatcggatccacgtcatt |
− | | | + | | beginning of gene |
− | | | + | | target coding strand |
− | | | + | | https://www.dropbox.com/scl/fi/im2nky48dz8dninn07pwk/TR_red_yield.xlsx?dl=0&rlkey=yhbf2t0sxdfmqxqkrrpc8hkah |
|- | |- | ||
| TR Orange | | TR Orange | ||
− | | | + | | Ethanol (E) |
− | | | + | | ''gltA'' |
− | | | + | | gaacacaccttttgaaccgagagta |
− | | | + | | beginning of gene |
− | | | + | | target coding strand |
− | | | + | | [[Media:TR Orange.xlsx | orange data]] |
|- | |- | ||
| TR Yellow | | TR Yellow | ||
− | | | + | | Ethanol (E) |
− | | | + | | ''pta-ack'' |
− | | | + | | GTTTTTTTAGCCACGTATCAATTAT |
− | | | + | | -35 region |
− | | | + | | noncoding strand |
− | | | + | | https://1drv.ms/x/s!AvcscE3syv-CgQfF_d8w80nc90RM |
|- | |- | ||
| TR Green | | TR Green | ||
− | | | + | | Ethanol (E) |
− | | | + | | ''aceE'' |
− | | | + | | TTATTCCTTATCTATCTAATAACGT |
− | | | + | | -30 region |
− | | | + | | coding strand |
− | | | + | | https://www.dropbox.com/scl/fi/yr9yndhh1h3hp8z8x0upf/TRGreen_M2D6Analysis.xlsx?dl=0&rlkey=3szzyw9psr0wqh1jdkroc7h6p |
|- | |- | ||
| TR Blue | | TR Blue | ||
− | | | + | | Acetate |
− | | | + | | ''aceE'' |
− | | | + | | GTCGCGAGTTTCGATCGGATCCACG |
− | | | + | | beginning of gene |
− | | | + | | coding strand |
− | | | + | | https://www.dropbox.com/s/cxxrl6zmj2ckeiy/TR_Blue_M2D6_Acetate_Data.xlsx?dl=0 |
|- | |- | ||
| TR Teal | | TR Teal | ||
− | | | + | | Acetate |
− | | | + | | ''aceE'' |
− | | | + | | CGTCATTTGGGAAACGTTCT |
− | | | + | | beginning of gene |
− | | | + | | coding strand |
− | | | + | | https://www.dropbox.com/scl/fi/yic9bw46ltim14xbxudwk/TR-Teal-M2D6_data_analysis.xlsx?dl=0&rlkey=z62dl8p8a4sanabelbrh3lgpn |
|- | |- | ||
| TR Pink | | TR Pink | ||
Line 188: | Line 208: | ||
|- | |- | ||
| TR Purple | | TR Purple | ||
− | | | + | | Ethanol |
− | | | + | | ''pta'' |
− | | | + | | GTAGGGATCAGCATAATAATAC |
− | | | + | | beginning of gene |
− | | | + | | coding (non-template) strand |
− | | | + | | https://mitprod-my.sharepoint.com/:x:/g/personal/alpusey_mit_edu/ET0pYqoAsbdMjiX3Kg8mItEB0BjTW_gz-6u_At07MqQxPw?e=MBvZ1U |
+ | |||
|- | |- | ||
| TR Grey | | TR Grey | ||
− | | | + | | Ethanol |
− | | | + | | ''aceE'' |
− | | | + | | CGTCATTTGGGAAACGTTCTGACAT |
− | | | + | | beginning of gene |
− | | | + | | noncoding strand |
− | | | + | | https://docs.google.com/spreadsheets/d/15mpS30zxthBy3nxzGolYUSkcbeGWi7QR/edit?usp=sharing&ouid=116057108253329472008&rtpof=true&sd=true |
|- | |- | ||
| TR White | | TR White | ||
− | | | + | | Ethanol |
− | | | + | | ''aceE'' |
− | | | + | | AGTTTCGATCGGATCCACGTCATTT |
− | | | + | | beginning of gene |
− | | | + | | targeting the coding strand (Non template) |
− | | | + | |https://www.dropbox.com/scl/fi/68akhe3zajc3gmvjlr40m/TR-White-Ethanol-Yield-Results.xlsx?dl=0&rlkey=cs9i029pdq8hyk2vuq6g3y3lb |
|} | |} | ||
Line 224: | Line 245: | ||
|- | |- | ||
| WF Red | | WF Red | ||
− | | | + | | Ethanol (E) |
− | | | + | | pta |
− | | | + | | gaccgacgctggttccggta |
− | | | + | | Beginning of coding sequence of gene |
− | | | + | | Coding |
| | | | ||
+ | https://mitprod-my.sharepoint.com/:x:/g/personal/mrowlett_mit_edu/EaRFR7TFOmhIucZzlLJylLwBfwhJs1lEEHUaMS5HK2YGdw?e=GpiHf9 | ||
|- | |- | ||
| WF Orange | | WF Orange | ||
− | | | + | | Ethanol (E) |
− | | | + | | pta |
− | | | + | | ttcgtagttcagagactgggcaaac |
− | | | + | | beginning of gene |
− | | | + | | coding |
− | | | + | |https://www.dropbox.com/s/e2glkl89k0e3n0j/WFOrangeEthanolAssay.xlsx?dl=0 |
|- | |- | ||
| WF Yellow | | WF Yellow | ||
− | | | + | |Ethanol (E) |
− | | | + | |ppc |
− | | | + | |CATTGCGTAGTAATGTCAGTATGC |
− | | | + | |beginning of gene |
− | | | + | |non-coding strand (template) |
− | | | + | |https://www.dropbox.com/s/oceuj929siygv6l/Sp22_M2D6_data_analysis_template.xlsx?dl=0 |
|- | |- | ||
| WF Green | | WF Green | ||
− | | | + | |Acetate (A) |
− | | | + | |ppc |
− | | | + | |CCCCAGACACCCCATCTTATCGTTT |
− | | | + | |promoter |
− | | | + | |coding strand (non template) |
− | | | + | |https://www.dropbox.com/s/yuajy4wjev9ejnn/Sp22_M2D6_data_analysis_template.xlsx?dl=0 |
|- | |- | ||
| WF Blue | | WF Blue | ||
− | | | + | | Acetate (A) |
− | | | + | | adhE |
− | | | + | | ttcagcgacattagtaacagcc |
− | | | + | | beginning of the gene |
− | | | + | | coding strand (non-template) |
− | | | + | | https://www.dropbox.com/s/xfhwywkx9q81dfm/WFBlue_M2D6_data_analysis_template.xlsx?dl=0 |
|- | |- | ||
| WF Teal | | WF Teal | ||
Line 272: | Line 294: | ||
|- | |- | ||
| WF Pink | | WF Pink | ||
− | | | + | | Ethanol (E) |
− | | | + | | ldhA |
− | | | + | | GTGATGTTGAATCACATTTAAGC |
− | | | + | | -35 |
− | | | + | | conding strand (non-template) |
− | | | + | |https://mitprod-my.sharepoint.com/:x:/g/personal/skykim_mit_edu/EVo2U1bwZYVMrI-QhOeU--YBpYk0ul4F-H-o2qfISl6Lkg?e=ht6H12 |
|- | |- | ||
| WF Purple | | WF Purple | ||
− | | | + | | Acetate (A) |
− | | | + | | adhE |
− | | | + | | gttcagcgacattagtaacagccat |
− | | | + | | beginning of gene |
− | | | + | | coding strand (non-template) |
− | | | + | | https://mitprod-my.sharepoint.com/:x:/g/personal/sabrliu_mit_edu/EQLNILyBeihNsubxjolVF24BT-TTYja33Pdp7lkFifthTw?e=kqYsM8 |
|- | |- | ||
| WF Grey | | WF Grey | ||
Line 296: | Line 318: | ||
|- | |- | ||
| WF White | | WF White | ||
− | | | + | | Acetate (A) |
− | | | + | | adhE |
− | | | + | | ACAATTTATTAACTGTTAGCTATAA |
− | | | + | | promoter (-10) |
− | | | + | | non-coding strand (template) |
− | | | + | |https://www.dropbox.com/scl/fi/a2u9gahr8lhvhxipvdj7x/White-Acetate-Data.xlsx?dl=0&rlkey=ow2gefah5hczpy3p8rb03efol |
|} | |} | ||
+ | |||
+ | ====Sequencing Data==== | ||
+ | |||
+ | [[https://www.dropbox.com/sh/jw3s2fmml3iux60/AACw-y8-uHnU_NnxoSDpTACla?dl=0 T/R sequencing files]] | ||
+ | [[https://www.dropbox.com/sh/e83l1nk3r1y8o1h/AAASE11ULHNVBuBfe42iXs1Wa?dl=0 W/F sequencing files]] |
Latest revision as of 18:20, 6 May 2022
Contents
Module 1: Drug discovery
SDS-PAGE gel images
small molecule selections
T/R
W/F
Aggregation Results
[T/R Aggregation dropbox folder]
Localization Results
Module 2: Metabolic engineering
Diagnostic Digest gels
[T/R diagnostic digest folder ]
[W/F Diagnostic Digest Folder]
sgRNA_target sequences
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target coding or non-coding strand | Ethanol / Acetate Assay Results |
TR Red | Acetate (A) | aceE | gagtttcgatcggatccacgtcatt | beginning of gene | target coding strand | https://www.dropbox.com/scl/fi/im2nky48dz8dninn07pwk/TR_red_yield.xlsx?dl=0&rlkey=yhbf2t0sxdfmqxqkrrpc8hkah |
TR Orange | Ethanol (E) | gltA | gaacacaccttttgaaccgagagta | beginning of gene | target coding strand | orange data |
TR Yellow | Ethanol (E) | pta-ack | GTTTTTTTAGCCACGTATCAATTAT | -35 region | noncoding strand | https://1drv.ms/x/s!AvcscE3syv-CgQfF_d8w80nc90RM |
TR Green | Ethanol (E) | aceE | TTATTCCTTATCTATCTAATAACGT | -30 region | coding strand | https://www.dropbox.com/scl/fi/yr9yndhh1h3hp8z8x0upf/TRGreen_M2D6Analysis.xlsx?dl=0&rlkey=3szzyw9psr0wqh1jdkroc7h6p |
TR Blue | Acetate | aceE | GTCGCGAGTTTCGATCGGATCCACG | beginning of gene | coding strand | https://www.dropbox.com/s/cxxrl6zmj2ckeiy/TR_Blue_M2D6_Acetate_Data.xlsx?dl=0 |
TR Teal | Acetate | aceE | CGTCATTTGGGAAACGTTCT | beginning of gene | coding strand | https://www.dropbox.com/scl/fi/yic9bw46ltim14xbxudwk/TR-Teal-M2D6_data_analysis.xlsx?dl=0&rlkey=z62dl8p8a4sanabelbrh3lgpn |
TR Pink | ||||||
TR Purple | Ethanol | pta | GTAGGGATCAGCATAATAATAC | beginning of gene | coding (non-template) strand | https://mitprod-my.sharepoint.com/:x:/g/personal/alpusey_mit_edu/ET0pYqoAsbdMjiX3Kg8mItEB0BjTW_gz-6u_At07MqQxPw?e=MBvZ1U |
TR Grey | Ethanol | aceE | CGTCATTTGGGAAACGTTCTGACAT | beginning of gene | noncoding strand | https://docs.google.com/spreadsheets/d/15mpS30zxthBy3nxzGolYUSkcbeGWi7QR/edit?usp=sharing&ouid=116057108253329472008&rtpof=true&sd=true |
TR White | Ethanol | aceE | AGTTTCGATCGGATCCACGTCATTT | beginning of gene | targeting the coding strand (Non template) | https://www.dropbox.com/scl/fi/68akhe3zajc3gmvjlr40m/TR-White-Ethanol-Yield-Results.xlsx?dl=0&rlkey=cs9i029pdq8hyk2vuq6g3y3lb |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target coding or non-coding strand | Colorimetric Assay Results |
WF Red | Ethanol (E) | pta | gaccgacgctggttccggta | Beginning of coding sequence of gene | Coding | |
WF Orange | Ethanol (E) | pta | ttcgtagttcagagactgggcaaac | beginning of gene | coding | https://www.dropbox.com/s/e2glkl89k0e3n0j/WFOrangeEthanolAssay.xlsx?dl=0 |
WF Yellow | Ethanol (E) | ppc | CATTGCGTAGTAATGTCAGTATGC | beginning of gene | non-coding strand (template) | https://www.dropbox.com/s/oceuj929siygv6l/Sp22_M2D6_data_analysis_template.xlsx?dl=0 |
WF Green | Acetate (A) | ppc | CCCCAGACACCCCATCTTATCGTTT | promoter | coding strand (non template) | https://www.dropbox.com/s/yuajy4wjev9ejnn/Sp22_M2D6_data_analysis_template.xlsx?dl=0 |
WF Blue | Acetate (A) | adhE | ttcagcgacattagtaacagcc | beginning of the gene | coding strand (non-template) | https://www.dropbox.com/s/xfhwywkx9q81dfm/WFBlue_M2D6_data_analysis_template.xlsx?dl=0 |
WF Teal | ||||||
WF Pink | Ethanol (E) | ldhA | GTGATGTTGAATCACATTTAAGC | -35 | conding strand (non-template) | https://mitprod-my.sharepoint.com/:x:/g/personal/skykim_mit_edu/EVo2U1bwZYVMrI-QhOeU--YBpYk0ul4F-H-o2qfISl6Lkg?e=ht6H12 |
WF Purple | Acetate (A) | adhE | gttcagcgacattagtaacagccat | beginning of gene | coding strand (non-template) | https://mitprod-my.sharepoint.com/:x:/g/personal/sabrliu_mit_edu/EQLNILyBeihNsubxjolVF24BT-TTYja33Pdp7lkFifthTw?e=kqYsM8 |
WF Grey | ||||||
WF White | Acetate (A) | adhE | ACAATTTATTAACTGTTAGCTATAA | promoter (-10) | non-coding strand (template) | https://www.dropbox.com/scl/fi/a2u9gahr8lhvhxipvdj7x/White-Acetate-Data.xlsx?dl=0&rlkey=ow2gefah5hczpy3p8rb03efol |