Difference between revisions of "Talk:20.109(F17):Module 2"

From Course Wiki
Jump to: navigation, search
(T/R)
(Compiled class colorimetric data)
 
(25 intermediate revisions by 11 users not shown)
Line 1: Line 1:
 +
===Compiled class colorimetric data===
 +
[[Media:Fa17_CombinedColorimetricAssay_Acetate.xlsx|Acetate Compiled Class Data]] <br>
 +
[[Media:Fa17_CombinedColorimetricAssay_Ethanol2.xlsx|Ethanol Compiled Class Data]]
 +
 
===Fermentation product and gene targeted:===
 
===Fermentation product and gene targeted:===
  
Line 15: Line 19:
 
| adhE
 
| adhE
 
| TTAACGCACTCGTAGAGCGTGTAAA
 
| TTAACGCACTCGTAGAGCGTGTAAA
|
+
| beginning of coding region
|
+
| non-template
 
|-
 
|-
 
|orange
 
|orange
Line 22: Line 26:
 
|pta-ack
 
|pta-ack
 
|CTATGGCTCCCTGACGTTTT
 
|CTATGGCTCCCTGACGTTTT
|
+
|promoter region
|
+
|template strand
 
|-
 
|-
 
|yellow
 
|yellow
Line 36: Line 40:
 
|LdhA
 
|LdhA
 
|ttgtgctataaacggcgagtttcat
 
|ttgtgctataaacggcgagtttcat
|
+
|The middle of the gene
|
+
|Non template strand
 
|-
 
|-
 
|blue
 
|blue
Line 43: Line 47:
 
|pta
 
|pta
 
|ttcacgacaacgttcaataatcat
 
|ttcacgacaacgttcaataatcat
|
+
|coding region
|
+
|non-template strand
 
|-
 
|-
 
|pink
 
|pink
Line 57: Line 61:
 
|adhE
 
|adhE
 
|TTTACTAAAAAAGTTTAACATTATC
 
|TTTACTAAAAAAGTTTAACATTATC
|"" -35 region""
+
|' -35 region'
|""template""
+
|'template'
 
|-
 
|-
 
|white
 
|white
Line 64: Line 68:
 
| adhE
 
| adhE
 
|CTGATAATGTTAAACTTTTT
 
|CTGATAATGTTAAACTTTTT
|
+
|promoter
|
+
|non-template strand
 
|}
 
|}
  
Line 82: Line 86:
 
| ack (indirectly, pta)
 
| ack (indirectly, pta)
 
| GTTTTTTTAGCCACGTATCAATTAT
 
| GTTTTTTTAGCCACGTATCAATTAT
|
+
| promoter region of ack
|
+
| Nontemplate strand
 
|-
 
|-
 
|orange
 
|orange
Line 89: Line 93:
 
|ldhA
 
|ldhA
 
|ATTCAACATCACTGGAGAAAGTCTT
 
|ATTCAACATCACTGGAGAAAGTCTT
|
+
|promoter
|
+
|template
 
|-
 
|-
 
|blue
 
|blue
Line 96: Line 100:
 
| ackA
 
| ackA
 
| TTTTTAGCCACGTATCAATTAT
 
| TTTTTAGCCACGTATCAATTAT
|
+
| promoter region of ackA, starting at -32
|
+
| nontemplate
 +
|}
 +
 
 +
====Instructor Data====
 +
 
 +
{| border=1px
 +
|'''Team'''
 +
|'''Ethanol (E) or Acetate (A)'''
 +
|'''Gene targeted by CRISPRi gRNA'''
 +
|'''gRNA sequence (without tag at 3' end)'''
 +
|'''Locus targeted (eg. beginning of gene, putative promoter, -35 region)'''
 +
|'''Target template or nontemplate strand'''
 +
|-
 +
|Instructor
 +
|Acetate
 +
|aceEF
 +
|GGAATAACCCatgtcagaacgtttc
 +
|5' UTR region and beginning of coding region
 +
|Template
 +
|-
 +
|Instructor
 +
|Acetate
 +
|adhE
 +
|AATGCTCTCCTGATAATGTTAAAC
 +
|Promoter and 5' UTR region right before coding region
 +
|Nontemplate
 
|}
 
|}
  

Latest revision as of 16:20, 16 November 2017

Compiled class colorimetric data

Acetate Compiled Class Data
Ethanol Compiled Class Data

Fermentation product and gene targeted:

T/R

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand
red Acetate adhE TTAACGCACTCGTAGAGCGTGTAAA beginning of coding region non-template
orange Ethanol pta-ack CTATGGCTCCCTGACGTTTT promoter region template strand
yellow Ethanol frdA GCTGTGGGATAAAAACAATCTGGAG minus 35 region template strand
green E LdhA ttgtgctataaacggcgagtttcat The middle of the gene Non template strand
blue E pta ttcacgacaacgttcaataatcat coding region non-template strand
pink Acetate adhE TTACTAAAAAAGTTTAACATTATCA promoter region template strand
purple Acetate adhE TTTACTAAAAAAGTTTAACATTATC ' -35 region' 'template'
white Acetate adhE CTGATAATGTTAAACTTTTT promoter non-template strand

W/F

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand
red Ethanol ack (indirectly, pta) GTTTTTTTAGCCACGTATCAATTAT promoter region of ack Nontemplate strand
orange Ethanol ldhA ATTCAACATCACTGGAGAAAGTCTT promoter template
blue Ethanol ackA TTTTTAGCCACGTATCAATTAT promoter region of ackA, starting at -32 nontemplate

Instructor Data

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand
Instructor Acetate aceEF GGAATAACCCatgtcagaacgtttc 5' UTR region and beginning of coding region Template
Instructor Acetate adhE AATGCTCTCCTGATAATGTTAAAC Promoter and 5' UTR region right before coding region Nontemplate

M2D5/M2D7: sequencing data

T/R

Team pgRNA sequencing
red files
orange files
yellow files
green files
blue files
pink files
purple files
white files

W/F

Team pgRNA sequencing
red files
orange files
blue files