Difference between revisions of "Talk:20.109(F17):Module 2"
From Course Wiki
(→Fermentation product and gene targeted:) |
(→Compiled class colorimetric data) |
||
(38 intermediate revisions by 14 users not shown) | |||
Line 1: | Line 1: | ||
+ | ===Compiled class colorimetric data=== | ||
+ | [[Media:Fa17_CombinedColorimetricAssay_Acetate.xlsx|Acetate Compiled Class Data]] <br> | ||
+ | [[Media:Fa17_CombinedColorimetricAssay_Ethanol2.xlsx|Ethanol Compiled Class Data]] | ||
+ | |||
===Fermentation product and gene targeted:=== | ===Fermentation product and gene targeted:=== | ||
Line 8: | Line 12: | ||
|'''Gene targeted by CRISPRi gRNA''' | |'''Gene targeted by CRISPRi gRNA''' | ||
|'''gRNA sequence (without tag at 3' end)''' | |'''gRNA sequence (without tag at 3' end)''' | ||
+ | |'''Locus targeted (eg. beginning of gene, putative promoter, -35 region)''' | ||
+ | |'''Target template or nontemplate strand''' | ||
|- | |- | ||
|red | |red | ||
Line 13: | Line 19: | ||
| adhE | | adhE | ||
| TTAACGCACTCGTAGAGCGTGTAAA | | TTAACGCACTCGTAGAGCGTGTAAA | ||
+ | | beginning of coding region | ||
+ | | non-template | ||
|- | |- | ||
|orange | |orange | ||
Line 18: | Line 26: | ||
|pta-ack | |pta-ack | ||
|CTATGGCTCCCTGACGTTTT | |CTATGGCTCCCTGACGTTTT | ||
+ | |promoter region | ||
+ | |template strand | ||
|- | |- | ||
|yellow | |yellow | ||
Line 23: | Line 33: | ||
|frdA | |frdA | ||
|GCTGTGGGATAAAAACAATCTGGAG | |GCTGTGGGATAAAAACAATCTGGAG | ||
+ | |minus 35 region | ||
+ | |template strand | ||
|- | |- | ||
|green | |green | ||
Line 28: | Line 40: | ||
|LdhA | |LdhA | ||
|ttgtgctataaacggcgagtttcat | |ttgtgctataaacggcgagtttcat | ||
+ | |The middle of the gene | ||
+ | |Non template strand | ||
|- | |- | ||
|blue | |blue | ||
Line 33: | Line 47: | ||
|pta | |pta | ||
|ttcacgacaacgttcaataatcat | |ttcacgacaacgttcaataatcat | ||
+ | |coding region | ||
+ | |non-template strand | ||
|- | |- | ||
|pink | |pink | ||
Line 38: | Line 54: | ||
|adhE | |adhE | ||
|TTACTAAAAAAGTTTAACATTATCA | |TTACTAAAAAAGTTTAACATTATCA | ||
+ | |promoter region | ||
+ | |template strand | ||
|- | |- | ||
|purple | |purple | ||
Line 43: | Line 61: | ||
|adhE | |adhE | ||
|TTTACTAAAAAAGTTTAACATTATC | |TTTACTAAAAAAGTTTAACATTATC | ||
+ | |' -35 region' | ||
+ | |'template' | ||
|- | |- | ||
|white | |white | ||
Line 48: | Line 68: | ||
| adhE | | adhE | ||
|CTGATAATGTTAAACTTTTT | |CTGATAATGTTAAACTTTTT | ||
+ | |promoter | ||
+ | |non-template strand | ||
|} | |} | ||
Line 57: | Line 79: | ||
|'''Gene targeted by CRISPRi gRNA''' | |'''Gene targeted by CRISPRi gRNA''' | ||
|'''gRNA sequence (without tag at 3' end)''' | |'''gRNA sequence (without tag at 3' end)''' | ||
+ | |'''Locus targeted (eg. beginning of gene, putative promoter, -35 region)''' | ||
+ | |'''Target template or nontemplate strand''' | ||
|- | |- | ||
|red | |red | ||
Line 62: | Line 86: | ||
| ack (indirectly, pta) | | ack (indirectly, pta) | ||
| GTTTTTTTAGCCACGTATCAATTAT | | GTTTTTTTAGCCACGTATCAATTAT | ||
+ | | promoter region of ack | ||
+ | | Nontemplate strand | ||
|- | |- | ||
|orange | |orange | ||
Line 67: | Line 93: | ||
|ldhA | |ldhA | ||
|ATTCAACATCACTGGAGAAAGTCTT | |ATTCAACATCACTGGAGAAAGTCTT | ||
+ | |promoter | ||
+ | |template | ||
|- | |- | ||
|blue | |blue | ||
Line 72: | Line 100: | ||
| ackA | | ackA | ||
| TTTTTAGCCACGTATCAATTAT | | TTTTTAGCCACGTATCAATTAT | ||
+ | | promoter region of ackA, starting at -32 | ||
+ | | nontemplate | ||
+ | |} | ||
+ | |||
+ | ====Instructor Data==== | ||
+ | |||
+ | {| border=1px | ||
+ | |'''Team''' | ||
+ | |'''Ethanol (E) or Acetate (A)''' | ||
+ | |'''Gene targeted by CRISPRi gRNA''' | ||
+ | |'''gRNA sequence (without tag at 3' end)''' | ||
+ | |'''Locus targeted (eg. beginning of gene, putative promoter, -35 region)''' | ||
+ | |'''Target template or nontemplate strand''' | ||
+ | |- | ||
+ | |Instructor | ||
+ | |Acetate | ||
+ | |aceEF | ||
+ | |GGAATAACCCatgtcagaacgtttc | ||
+ | |5' UTR region and beginning of coding region | ||
+ | |Template | ||
+ | |- | ||
+ | |Instructor | ||
+ | |Acetate | ||
+ | |adhE | ||
+ | |AATGCTCTCCTGATAATGTTAAAC | ||
+ | |Promoter and 5' UTR region right before coding region | ||
+ | |Nontemplate | ||
+ | |} | ||
+ | |||
+ | ===M2D5/M2D7: sequencing data=== | ||
+ | |||
+ | ====T/R==== | ||
+ | |||
+ | {| border=1px | ||
+ | |'''Team''' | ||
+ | |'''pgRNA sequencing''' | ||
+ | |- | ||
+ | |red | ||
+ | |[[Media:Fa17 TR Red M2 seq.zip| files]] | ||
+ | |- | ||
+ | |orange | ||
+ | |[[Media:Fa17 TR Orange M2 seq.zip| files]] | ||
+ | |- | ||
+ | |yellow | ||
+ | |[[Media:Fa17 TR Yellow M2 seq.zip| files]] | ||
+ | |- | ||
+ | |green | ||
+ | |[[Media:Fa17 TR Green M2 seq.zip| files]] | ||
+ | |- | ||
+ | |blue | ||
+ | |[[Media:Fa17 TR Blue M2 seq.zip| files]] | ||
+ | |- | ||
+ | |pink | ||
+ | |[[Media:Fa17 TR Pink M2 seq.zip| files]] | ||
+ | |- | ||
+ | |purple | ||
+ | |[[Media:Fa17 TR Purple M2 seq.zip| files]] | ||
+ | |- | ||
+ | |white | ||
+ | |[[Media:Fa17 TR White M2 seq.zip| files]] | ||
+ | |- | ||
+ | |} | ||
+ | |||
+ | ====W/F==== | ||
+ | |||
+ | {| border=1px | ||
+ | |'''Team''' | ||
+ | |'''pgRNA sequencing''' | ||
+ | |- | ||
+ | |red | ||
+ | |[[Media:Fa17 WF Red M2 seq.zip| files]] | ||
+ | |- | ||
+ | |orange | ||
+ | |[[Media:Fa17 WF Orange M2 seq.zip| files]] | ||
+ | |- | ||
+ | |blue | ||
+ | |[[Media:Fa17 WF Blue M2 seq.zip| files]] | ||
+ | |- | ||
|} | |} |
Latest revision as of 16:20, 16 November 2017
Contents
Compiled class colorimetric data
Acetate Compiled Class Data
Ethanol Compiled Class Data
Fermentation product and gene targeted:
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
red | Acetate | adhE | TTAACGCACTCGTAGAGCGTGTAAA | beginning of coding region | non-template |
orange | Ethanol | pta-ack | CTATGGCTCCCTGACGTTTT | promoter region | template strand |
yellow | Ethanol | frdA | GCTGTGGGATAAAAACAATCTGGAG | minus 35 region | template strand |
green | E | LdhA | ttgtgctataaacggcgagtttcat | The middle of the gene | Non template strand |
blue | E | pta | ttcacgacaacgttcaataatcat | coding region | non-template strand |
pink | Acetate | adhE | TTACTAAAAAAGTTTAACATTATCA | promoter region | template strand |
purple | Acetate | adhE | TTTACTAAAAAAGTTTAACATTATC | ' -35 region' | 'template' |
white | Acetate | adhE | CTGATAATGTTAAACTTTTT | promoter | non-template strand |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
red | Ethanol | ack (indirectly, pta) | GTTTTTTTAGCCACGTATCAATTAT | promoter region of ack | Nontemplate strand |
orange | Ethanol | ldhA | ATTCAACATCACTGGAGAAAGTCTT | promoter | template |
blue | Ethanol | ackA | TTTTTAGCCACGTATCAATTAT | promoter region of ackA, starting at -32 | nontemplate |
Instructor Data
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
Instructor | Acetate | aceEF | GGAATAACCCatgtcagaacgtttc | 5' UTR region and beginning of coding region | Template |
Instructor | Acetate | adhE | AATGCTCTCCTGATAATGTTAAAC | Promoter and 5' UTR region right before coding region | Nontemplate |
M2D5/M2D7: sequencing data
T/R
Team | pgRNA sequencing |
red | files |
orange | files |
yellow | files |
green | files |
blue | files |
pink | files |
purple | files |
white | files |
W/F
Team | pgRNA sequencing |
red | files |
orange | files |
blue | files |