Difference between revisions of "20.109(F18):Class data"
From Course Wiki
(→Fermentation product and gene targeted:) |
(→TR Battery information) |
||
(40 intermediate revisions by 12 users not shown) | |||
Line 131: | Line 131: | ||
| pta | | pta | ||
| TGCGCCCGATCAGACTACGACTATC | | TGCGCCCGATCAGACTACGACTATC | ||
− | | | + | | Coding region |
− | | | + | | template |
|[[File: TRRed_ethanol_rawdata.xlsx | Raw data ]] | |[[File: TRRed_ethanol_rawdata.xlsx | Raw data ]] | ||
|- | |- | ||
Line 140: | Line 140: | ||
|gttgcaggtacttcttgtcgt | |gttgcaggtacttcttgtcgt | ||
|32 bps downstream from start of gene | |32 bps downstream from start of gene | ||
− | | | + | |Nontemplate Strand |
|[[File: TROrange_ethanol_rawdata.xlsx | Raw data ]] | |[[File: TROrange_ethanol_rawdata.xlsx | Raw data ]] | ||
|- | |- | ||
Line 147: | Line 147: | ||
|adhE | |adhE | ||
|TACTAAAAAAGTTTAACATTATCA | |TACTAAAAAAGTTTAACATTATCA | ||
− | |locus targeted: - | + | |locus targeted: -34 upstream (promoter) |
|Template strand | |Template strand | ||
|[[File: TRGreen_acetate_rawdata.xlsx | Raw data ]] | |[[File: TRGreen_acetate_rawdata.xlsx | Raw data ]] | ||
Line 166: | Line 166: | ||
|Non-template strand | |Non-template strand | ||
|[[File: TRPurple_acetate_rawdata.xlsx | Raw data ]] | |[[File: TRPurple_acetate_rawdata.xlsx | Raw data ]] | ||
− | |||
|} | |} | ||
Line 184: | Line 183: | ||
| adhE | | adhE | ||
| ATTCGAGCAGATGATTTACTAAAAA | | ATTCGAGCAGATGATTTACTAAAAA | ||
− | | | + | | locus targeted: -50 upstream; promoter |
− | | | + | | template strand |
− | |[[File: | + | |[[File: WFyellow_Acetate_RawData.xlsx | Raw data ]] |
|- | |- | ||
|WF green | |WF green | ||
Line 192: | Line 191: | ||
| adhE | | adhE | ||
| TTACTAAAAAAGTTTAACATTATCA | | TTACTAAAAAAGTTTAACATTATCA | ||
− | | | + | | locus targeted: -35 upstream (promoter) |
− | | | + | | template strand |
− | |[[File: | + | |[[File: WFGreen_Acetate_RawData.xlsx | Raw data ]] |
|- | |- | ||
|WF blue | |WF blue | ||
Line 200: | Line 199: | ||
| adhE | | adhE | ||
| TTCGAGCAGATGATTTACTAAA | | TTCGAGCAGATGATTTACTAAA | ||
− | | locus targeted: - | + | | locus targeted: -49 upstream (promoter) |
| Template Strand | | Template Strand | ||
− | |[[File: | + | |[[File: WFBlue_Acetate_RawData.xlsx | Raw data ]] |
|} | |} | ||
Line 245: | Line 244: | ||
|[[Media:Fa18 WF blue.zip| files]] | |[[Media:Fa18 WF blue.zip| files]] | ||
|- | |- | ||
+ | |} | ||
+ | |||
+ | |||
+ | |||
+ | |||
+ | =Module 3= | ||
+ | |||
+ | ===Battery Capacity Raw Data=== | ||
+ | [[Media:Fa18_BatteryCapacityRawData.xlsx |Battery Capacity Raw Data]]<br> | ||
+ | |||
+ | ===No-gold battery data=== | ||
+ | [[Media:Fa18_NoGoldControl.zip|No gold control TEM and EDX images]]<br> | ||
+ | |||
+ | {| border=1px | ||
+ | |'''Experimental battery composition (AuNP/phage)''' | ||
+ | |'''Weight of cathode (mg)''' | ||
+ | |'''Actual capacity (mA*h/g)''' | ||
+ | |- | ||
+ | | 0 | ||
+ | | 2.15 mg | ||
+ | | 95.09 | ||
+ | |- | ||
+ | | 0 | ||
+ | | 2.37 mg | ||
+ | | 89.47 | ||
+ | |} | ||
+ | |||
+ | ===TR Battery information=== | ||
+ | {| border=1px | ||
+ | |'''Team''' | ||
+ | |'''Experimental battery composition (AuNP/phage)''' | ||
+ | |'''Weight of cathode (mg)''' | ||
+ | |'''Actual capacity (mA*h/g)''' | ||
+ | |- | ||
+ | |Red | ||
+ | | 25 | ||
+ | | 2.15 | ||
+ | | 44.0999 | ||
+ | |- | ||
+ | |Orange | ||
+ | |10 | ||
+ | |2.87 | ||
+ | |20.2247191 | ||
+ | |- | ||
+ | |Green | ||
+ | |23 | ||
+ | |3.88 | ||
+ | |85.67201222 | ||
+ | |- | ||
+ | |Pink | ||
+ | |35 | ||
+ | |1.55 | ||
+ | |29.39068 | ||
+ | |- | ||
+ | |Purple | ||
+ | |18 | ||
+ | |1.71 | ||
+ | |42.12692 | ||
+ | |- | ||
+ | |Yellow | ||
+ | |20 | ||
+ | |2.2 | ||
+ | |21.1 | ||
+ | |} | ||
+ | |||
+ | ===WF Battery information=== | ||
+ | {| border=1px | ||
+ | |'''Team''' | ||
+ | |'''Experimental battery composition (AuNP/phage)''' | ||
+ | |'''Weight of cathode (mg)''' | ||
+ | |'''Actual capacity (mA*h/g)''' | ||
+ | |- | ||
+ | |Yellow | ||
+ | |20 | ||
+ | |1.93 | ||
+ | |123.296872 | ||
+ | |- | ||
+ | |Green | ||
+ | |20 | ||
+ | |2.59 | ||
+ | |88.94609 | ||
+ | |- | ||
+ | |Blue | ||
+ | | 40 | ||
+ | | 3.1 | ||
+ | | 89.00836 | ||
|} | |} |
Latest revision as of 17:43, 7 May 2019
Contents
Module 1
Cell Loading Data
CometChip Data
Team | Analyzed Data |
T/R red | Analyzed CometChip data |
T/R orange | Analyzed CometChip data |
T/R green | Analyzed CometChip data |
T/R pink | Analyzed CometChip data |
T/R purple | Analyzed CometChip data |
Team | Analyzed Data |
W/F yellow | Analyzed CometChip data |
W/F green | Analyzed CometChip data |
W/F blue | Analyzed CometChip data |
W/F pink | Analyzed CometChip data |
gamma-H2AX Data
Team | Recovery time (min) | Raw gamma-H2AX Data | Analyzed gamma-H2AX Data |
T/R red | 30 | raw data | analyzed data |
T/R orange | 30 | raw data | analyzed data |
T/R green | 30 | raw data | analyzed data |
T/R pink | 30 | raw data | analyzed data |
T/R purple | 60 | raw data | analyzed data |
Team | Recovery time (min) | Raw gamma-H2AX Data | Analyzed gamma-H2AX Data |
W/F yellow | 30 | raw data | analyzed data |
W/F green | 30 | raw data | analyzed data |
W/F blue | 60 | raw data | analyzed data |
W/F pink | 30 | raw data | analyzed data |
Module 2
Fermentation product and gene targeted:
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
TR red | E | pta | TGCGCCCGATCAGACTACGACTATC | Coding region | template | File:TRRed ethanol rawdata.xlsx |
TR orange | E | ldhA | gttgcaggtacttcttgtcgt | 32 bps downstream from start of gene | Nontemplate Strand | File:TROrange ethanol rawdata.xlsx |
TR green | A | adhE | TACTAAAAAAGTTTAACATTATCA | locus targeted: -34 upstream (promoter) | Template strand | File:TRGreen acetate rawdata.xlsx |
TR pink | A | Citrate Synthase (gltA) | tgagttttgcttttgtatcagccat | Beginning of gene | Non-template Strand | File:TRPink acetate rawdata.xlsx |
TR purple | A | ldhA | TAGTAGCTTAAATGTGATTCAACAT | Locus targeted: -40 upstream region (promoter) | Non-template strand | File:TRPurple acetate rawdata.xlsx |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
WF yellow | A | adhE | ATTCGAGCAGATGATTTACTAAAAA | locus targeted: -50 upstream; promoter | template strand | File:WFyellow Acetate RawData.xlsx |
WF green | Acetate | adhE | TTACTAAAAAAGTTTAACATTATCA | locus targeted: -35 upstream (promoter) | template strand | File:WFGreen Acetate RawData.xlsx |
WF blue | A | adhE | TTCGAGCAGATGATTTACTAAA | locus targeted: -49 upstream (promoter) | Template Strand | File:WFBlue Acetate RawData.xlsx |
gRNA_target Sequencing Results
T/R
Team | pgRNA sequencing |
red | files |
orange | files |
green | files |
pink | files |
purple | files |
W/F
Team | pgRNA sequencing |
yellow | files |
green | files |
blue | files |
Module 3
Battery Capacity Raw Data
No-gold battery data
No gold control TEM and EDX images
Experimental battery composition (AuNP/phage) | Weight of cathode (mg) | Actual capacity (mA*h/g) |
0 | 2.15 mg | 95.09 |
0 | 2.37 mg | 89.47 |
TR Battery information
Team | Experimental battery composition (AuNP/phage) | Weight of cathode (mg) | Actual capacity (mA*h/g) |
Red | 25 | 2.15 | 44.0999 |
Orange | 10 | 2.87 | 20.2247191 |
Green | 23 | 3.88 | 85.67201222 |
Pink | 35 | 1.55 | 29.39068 |
Purple | 18 | 1.71 | 42.12692 |
Yellow | 20 | 2.2 | 21.1 |
WF Battery information
Team | Experimental battery composition (AuNP/phage) | Weight of cathode (mg) | Actual capacity (mA*h/g) |
Yellow | 20 | 1.93 | 123.296872 |
Green | 20 | 2.59 | 88.94609 |
Blue | 40 | 3.1 | 89.00836 |