Difference between revisions of "20.109(F19):Class data"
From Course Wiki
(→Fermentation product and gene targeted:) |
(→T/R) |
||
Line 112: | Line 112: | ||
|E | |E | ||
| adhE | | adhE | ||
− | | | + | | ccagagcggcggcgcggaag |
| Coding region | | Coding region | ||
| Non-template | | Non-template |
Revision as of 19:52, 10 October 2019
Contents
Module 1: Measuring genomic instability
M1D5
gamma-H2AX analysis
Team | Upload, then link the completed excel spreadsheet from the wiki here! |
TR Orange | Orange Team Data |
TR Yellow | Yellow Team Data |
TR Green | Green Team Data |
TR Blue | Blue Team Data |
TR Pink | Pink Team Data |
TR Purple | Purple Team Data |
WF Team | WF Team Data |
M1D6
Comet Chip analysis
Team | |
TR Orange | Orange Team Data |
TR Yellow | Yellow Team Data |
TR Green | Green Team Data |
TR Blue | Blue Team Data |
TR Pink | Pink Team Data |
TR Purple | Purple Team Data |
WF Team | WF Team Data |
Fermentation product and gene targeted:
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
TR example | E | pta | ccagagcggcggcgcggaag | Coding region | Non-template | [[File: | Raw data ]] |
TR orange | [[File: | Raw data ]] | |||||
TR yellow | E | ldhA | AAATTCCAGCTCAAAGCCAAAGG | Coding region | Non-template | [[File: | Raw data ]] |
TR green | E | ack | TTAGCCACGTATCAATTATAGG | Promoter Region | Template | [[File: | Raw data ]] |
TR blue | E | adhE | ccagagcggcggcgcggaag | Coding region | Non-template | [[File: | Raw data ]] |
TR pink | E | ppc | CATTGCGTAGTAATGTCAGTATGCT | Coding region | Template | [[File: | Raw data ]] |
TR purple | E | ldhA | CTTAAATGTGATTCAACATCACTGG | Promoter region | Template | [[File: | Raw data ]] |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
WF team | [[File: | Raw data ]] |