Difference between revisions of "20.109(F19):Design gRNA for CRISPRi (Day2)"

From Course Wiki
Jump to: navigation, search
(Reagents)
Line 81: Line 81:
 
The teaching faculty will order your gRNA as an oligo or primer from Genewiz.
 
The teaching faculty will order your gRNA as an oligo or primer from Genewiz.
  
==Reagents==
+
==Reagents list==
 
*1X TAE gel electrophoresis buffer: (BioRad)
 
*1X TAE gel electrophoresis buffer: (BioRad)
 
**40 mM Tris
 
**40 mM Tris

Revision as of 23:10, 14 August 2019

20.109(F19): Laboratory Fundamentals of Biological Engineering

Fa19 20109 Banner image.png

Fall 2019 schedule        FYI        Assignments        Homework        Class data        Communication
       1. Measuring genomic instability        2. Modulating metabolism        3. Testing chemical probes              


Introduction

In this module we will ‘manipulate’ or ‘engineer’ the metabolism of E. coli in an attempt to increase the production of commercially relevant products. Metabolic engineering refers to the alteration of genetic and/or regulatory circuitry within organisms. The native circuitry involves a series of enzymes that perform biochemical reactions that function to convert raw substrates into products that are required for the organism’s survival. When this native circuitry is altered using metabolic engineering techniques, the goal is to use the host organisms as machines that produce valuable materials in large quantities and at low cost.

Common strategies employed in metabolic engineering are:

  • Increasing expression of a gene that encodes an enzyme responsible for a rate-limiting step.
  • Inhibiting competing pathways that divert substrate away from the pathway of interest.
  • Incorporating genes from other organisms into the host.
  • Altering the structure of the enzyme such that yield is increased.

The products that you will target for your experiments are ethanol and acetate. Ethanol, or ethyl alcohol, is used as fuel – most commonly as a biofuel additive in gasoline. Current methods for producing ethanol involve the use of agricultural feedstocks and concern is mounting given the effect this may have on food prices and resources. Using E. coli as an ethanol-generating machine is promising; however, the ethanol output of a native cell is very low. Acetate is a salt combined that results from the combination of acetic acid with an alkaline, earthy, or metallic base. The majority of the 5 billion kilograms of acetic acid produced each year by industry are used to produce acetates, which are then used in the production of polymers. As with ethanol, the use of E. coli to generate lactate is of interest, but the amount produced by a native cell is low.

To manipulate the metabolism of E. coli, you will use the CRISPRi system. Today you will design a guide RNA (gRNA) that specifically targets a gene within the fermentation pathway of E. coli.

Protocols

During your last laboratory session you completed an experiment to confirm the pdCas9 plasmid. Today you will examine the results of your digests and perform the next stage of preparatory work by selecting a target for your metabolism engineering project. Upon determining which gene you will target, you will design a CRISPRi gRNA specific to your target.

Part 1: Agarose gel electrophoresis of confirmation digests

Electrophoresis is a technique that separates large molecules by size using an applied electrical field and a sieving matrix. DNA, RNA and proteins are the molecules most often studied with this technique; agarose and acrylamide gels are the two most common sieves. The molecules to be separated enter the matrix through a well at one end and are pulled through the matrix when a current is applied across it. The larger molecules get entwined in the matrix and are stalled; the smaller molecules wind through the matrix more easily and travel farther away from the well. The distance a DNA fragment travels is inversely proportional to the log of its length. Over time fragments of similar length accumulate into “bands” in the gel. Higher concentrations of agarose can be used to resolve smaller DNA fragments.

Diagram of gel electrophoresis chamber. Larger sized DNA molecules will remain close to the well where the sample was loaded and smaller DNA molecules will migrate through the gel toward the positive electrode.

DNA and RNA are negatively charged molecules due to their phosphate backbone, and they naturally travel toward the positive electrode at the far end of the gel. Today you will separate DNA fragments using an agarose matrix. Agarose is a polymer that comes from seaweed and if you’ve ever made Jell-O™, then you already have all the skills needed for pouring an agarose gel! To prepare these gels, agarose and 1X TAE buffer (Tris base, acetic acid, and EDTA) are microwaved until the agarose is melted and fully dissolved. The molten agar is then poured into a horizontal casting tray, and a comb is added. Once the agar has solidified, the comb is removed, leaving wells into which the DNA samples can be loaded.

You will use a 1% agarose gel (prepared by the teaching faculty) to separate the DNA fragments in your four digested samples as well as a reference lane of molecular weight markers (also called a DNA ladder).

  1. Add 5 μL of 6x loading dye to the digests.
    Illustration of proper gel loading technique.
    • Loading dye contains bromophenol blue as a tracking dye to follow the progress of the electrophoresis (so you don’t run the smallest fragments off the end of your gel!) as well as glycerol to help the samples sink into the wells.
  2. Flick the eppendorf tubes to mix the contents, then quick spin them in the microfuge to bring the contents of the tubes to the bottom.
  3. Load 25 μL of each digest into the gel, as well as 10 μL of 1kb DNA ladder.
    • Be sure to record the order in which you load your samples!
    • To load your samples, draw the volume listed above into the tip of your P200 or P20. Lower the tip below the surface of the buffer and directly over the well. Avoid lowering the tip too far into the well itself so as to not puncture the well. Expel your sample slowly into the well. Do not release the pipet plunger until after you have removed the tip from the gel box (or you'll draw your sample back into the tip!).
  4. Once all the samples have been loaded, attach the gel box to the power supply and run the gel at 125 V for 45 minutes.

Part 2: Select E. coli fermentation pathway protein to target

Your goal in this module is to increase the production of either ethanol or acetate, two valuable products of the E. coli mixed-acid fermentation pathway. You will complete this task using the CRISPRi system, which targets genes such that transcription of the target gene is decreased, thus resulting in less of the protein encoded by the targeted gene.

Example illustrating pathway to desired product.
To increase production of a desired product, you can either target proteins that use the substrate to generate alternate products (see A in image on right) or you can target proteins that use the desired product to generate alternate products (see B in image on right). In A the substrate is siphoned away from the reaction that generates the desired product and in B the desired product is used as substrate in a subsequent reaction. By eliminating the proteins that catalyze the reactions that result in alternate products, you can potentially increase production of your desired product.

Use the fermentation pathway from E. coli (included below) and the example above to answer the following questions with your partner.

  1. Which gene(s) might you target to increase the availability of substrate for ethanol production? For acetate production?
  2. Which gene(s) might you target to decrease the amount of substrate used to generate products in steps downstream of ethanol production? of acetate production?
Mixed-acid fermentation in E. coli. Image from Forster and Gescher, Front. in Bioeng. and Biotech., 2014.

With your laboratory partner, review Metabolic engineering of Escherichia coli for production of mixed-acid fermentation end products by Forster & Gescher. Using the information within this article and the genes that you identified above, select one gene that you will target in an attempt to increase the production of either ethanol or acetate. Be sure to include notes on your decision and thought process in your laboratory notebook.

Before you continue, note the fermentation product you aim to increase and the gene you will target in the Class Data Page.

Part 3: Design gRNA for CRISPRi system

Now that you know which gene you will target with the CRIPSRi system, you need to design a guide RNA (gRNA) using the DNA sequence. As a reminder, the gRNA recruits dCas9 to a specific location in the genome where it will bind and block transcription. The CRISPRi system can block transcription at either the initiation or elongation steps of transcription (see below image). If the dCas9 protein is bound to the promoter sequence at either a transcription factor binding site (TFBS) or the -10/-35 boxes it will block transcription factors and/or RNA polymerase from binding to the promoter of the gene, thereby impeding transcription initiation. If the dCas9 protein is bound within the gene it impede RNA polymerase elongation of the transcript. Consider both options with your partner and decide on a strategy before working through the remaining protocol. And, as always, record your thoughts in your notebook.

Target options for gRNA design. Image modified from Larson et al., Nature Prot., 2013. NT = nontemplate and T = template.

When you decide on which region of your target gene you will use to design your gRNA follow the steps below to choose a gRNA sequence.

  1. Use the KEGG Database to obtain the DNA sequence of your target gene in the E. coli K-12 MG1655 strain.
    • Enter the name of your target gene in the Search genes box and click Go.
    • Double click on the linked gene name.
  2. Using the information provided by the KEGG database, answer the following questions:
    • What is the full name of your gene (or Definition)?
    • In what pathways is your gene involved?
  3. Determine the position of your gene within the genome by clicking the Genome map button within the Position row.
    • Is your target gene at the start of an operon or in the middle?
    • Does the position of your gene within the operon affect the gRNA strategy you discussed with your partner? If you are unsure, consult with the teaching faculty.
  4. The amino acid (AA) sequence and nucleotide sequence (NT) of your gene are provided at the bottom of the page.
    • Generate a new sequence file in Benchling that contains the NT sequence of your gene.
    • If you will design a gRNA that binds the promoter, enter 50 in the +upstream box to get the 50 basepair sequence immediately preceding the start codon.
  5. Use the DNA sequence to select a 20-25 basepair region that will serve as the gRNA binding site. Please make sure your sequence does not exceed 25 bp.
    • If you target the template DNA strand, the gRNA sequence will be the same as the transcribed sequence.
    • If you target the nontemplate strand, the gRNA sequence will be the reverse-complement of the transcribed sequence.
  6. To avoid off-target effects, check the specificity of your gRNA sequence using the Basic Local Alignment Search Tool (BLAST) available from NCBI.
    • Click on the Nucleotide BLAST icon.
    • In the Enter Query Sequence section, paste your gRNA sequence into the Enter accession number(s), gi(s), or FASTA sequence(s) box.
    • In the Choose Search Set section, type 'MG1655' in the Organism box and select an appropriate option from the drop down list.
    • Click the BLAST button at the bottom of the screen.
  7. Ideally, your gRNA sequence will only have 100% identity to the target sequence.
    • If your gRNA sequence binds to multiple locations (with a 14+ nucleotide region within the gRNA having 100% identity to an off-target) within the genome, consider redesigning your gRNA.
  8. When you are satisfied with your gRNA sequence selection, post it to the Class Data Page.
    • Be sure you write your gRNA sequence 5' → 3'.

Additional sequence information must be added to your gRNA for the CRISPRi system. As discussed in lecture, a 'tag' is required for dCas9 binding at the target site . The tag sequence 5' - GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGC - 3' will be included at the 3' end of your gRNA. Please double check that in total, your full sequence is 60 bp or fewer.

The teaching faculty will order your gRNA as an oligo or primer from Genewiz.

Reagents list

  • 1X TAE gel electrophoresis buffer: (BioRad)
    • 40 mM Tris
    • 20 mM acetic acid
    • 1 mM EDTA
  • 6X gel loading dye, blue (NEB)
  • 1 kb DNA ladder (NEB)
  • SYBR Safe DNA Gel Stain (ThermoFisher)

Navigation links

Next day: Generate gRNA plasmid

Previous day: Complete in silico cloning of pdCas9