20.109(S22):Class data
From Course Wiki
Contents
Module 1: Drug discovery
SDS-PAGE gel images
small molecule selections
T/R
W/F
Aggregation Results
[T/R Aggregation dropbox folder]
Localization Results
Module 2: Metabolic engineering
Diagnostic Digest gels
[T/R diagnostic digest folder ]
[W/F Diagnostic Digest Folder]
sgRNA_target sequences
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target coding or non-coding strand | Ethanol / Acetate Assay Results | ||||
TR Red | Acetate (A) | aceE | gagtttcgatcggatccacgtcatt | beginning of gene | target coding strand | |||||
TR Orange | Ethanol (E) | gltA | gaacacaccttttgaaccgagagta | beginning of gene | target coding strand | |||||
TR Yellow | Ethanol (E) | pta-ack | GTTTTTTTAGCCACGTATCAATTAT | -35 region | noncoding strand | |||||
TR Green | Ethanol (E) | aceE | TTATTCCTTATCTATCTAATAACGT | -30 region | coding strand | |||||
TR Blue | Acetate | aceE | GTCGCGAGTTTCGATCGGATCCACG | beginning of gene | coding strand | |||||
TR Teal | Acetate | aceE | CGTCATTTGGGAAACGTTCT | beginning of gene | coding strand | |||||
TR Pink | ||||||||||
TR Purple | Ethanol | pta | GTAGGGATCAGCATAATAATAC | beginning of gene | non-template strand | |||||
TR Grey | Ethanol | aceE | CGTCATTTGGGAAACGTTCTGACAT | beginning of gene | noncoding strand | |||||
TR White | Ethanol | aceE | AGTTTCGATCGGATCCACGTCATTT | beginning of gene | targeting the coding strand (Non template) |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target coding or non-coding strand | Colorimetric Assay Results |
WF Red | Ethanol (E) | pta | gaccgacgctggttccggta | Beginning of coding sequence of gene | Coding | |
WF Orange | ||||||
WF Yellow | ||||||
WF Green | Acetate (A) | ppc | CCCCAGACACCCCATCTTATCGTTT | promoter | coding strand (non template) | |
WF Blue | ||||||
WF Teal | ||||||
WF Pink | ||||||
WF Purple | Acetate (A) | adhE | gttcagcgacattagtaacagccat | beginning of gene | coding strand (non-template) | |
WF Grey | ||||||
WF White |