Talk:20.109(F17):Module 2

From Course Wiki
Revision as of 18:44, 7 November 2017 by Shalnik (Talk | contribs)

Jump to: navigation, search

Fermentation product and gene targeted:

T/R

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand
red Acetate adhE TTAACGCACTCGTAGAGCGTGTAAA beginning of coding region
orange Ethanol pta-ack CTATGGCTCCCTGACGTTTT
yellow Ethanol frdA GCTGTGGGATAAAAACAATCTGGAG minus 35 region template strand
green E LdhA ttgtgctataaacggcgagtttcat
blue E pta ttcacgacaacgttcaataatcat coding region non-template strand
pink Acetate adhE TTACTAAAAAAGTTTAACATTATCA promoter region template strand
purple Acetate adhE TTTACTAAAAAAGTTTAACATTATC ' -35 region' 'template'
white Acetate adhE CTGATAATGTTAAACTTTTT promoter non-template strand

W/F

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand
red Ethanol ack (indirectly, pta) GTTTTTTTAGCCACGTATCAATTAT promoter region of ack Nontemplate strand
orange Ethanol ldhA ATTCAACATCACTGGAGAAAGTCTT promoter template
blue Ethanol ackA TTTTTAGCCACGTATCAATTAT promoter region of ackA, starting at -32 nontemplate

Instructor Data

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand
Instructor Acetate aceEF GGAATAACCCatgtcagaacgtttc 5' UTR region and beginning of coding region Template
Instructor Acetate adhE (1) GGAGAGCATTatggctgttactaatg 5' UTR region and beginning of coding region Template
Instructor Acetate adhE (2) AATGCTCTCCTGATAATGTTAAAC Promoter and 5' UTR region right before coding region Nontemplate

M2D5/M2D7: sequencing data

T/R

Team pgRNA sequencing
red files
orange files
yellow files
green files
blue files
pink files
purple files
white files

W/F

Team pgRNA sequencing
red files
orange files
blue files