Difference between revisions of "Talk:20.109(F17):Module 2"
From Course Wiki
(→Instructor Data) |
|||
Line 1: | Line 1: | ||
+ | ===Compiled class colorimetric data=== | ||
+ | [[Media:Fa17_CombinedColorimetricAssay_Acetate|Acetate Compiled Class Data]] | ||
+ | |||
+ | |||
===Fermentation product and gene targeted:=== | ===Fermentation product and gene targeted:=== | ||
Revision as of 21:59, 8 November 2017
Contents
Compiled class colorimetric data
Fermentation product and gene targeted:
T/R
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
red | Acetate | adhE | TTAACGCACTCGTAGAGCGTGTAAA | beginning of coding region | non-template |
orange | Ethanol | pta-ack | CTATGGCTCCCTGACGTTTT | promoter region | template strand |
yellow | Ethanol | frdA | GCTGTGGGATAAAAACAATCTGGAG | minus 35 region | template strand |
green | E | LdhA | ttgtgctataaacggcgagtttcat | The middle of the gene | Non template strand |
blue | E | pta | ttcacgacaacgttcaataatcat | coding region | non-template strand |
pink | Acetate | adhE | TTACTAAAAAAGTTTAACATTATCA | promoter region | template strand |
purple | Acetate | adhE | TTTACTAAAAAAGTTTAACATTATC | ' -35 region' | 'template' |
white | Acetate | adhE | CTGATAATGTTAAACTTTTT | promoter | non-template strand |
W/F
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
red | Ethanol | ack (indirectly, pta) | GTTTTTTTAGCCACGTATCAATTAT | promoter region of ack | Nontemplate strand |
orange | Ethanol | ldhA | ATTCAACATCACTGGAGAAAGTCTT | promoter | template |
blue | Ethanol | ackA | TTTTTAGCCACGTATCAATTAT | promoter region of ackA, starting at -32 | nontemplate |
Instructor Data
Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
Instructor | Acetate | aceEF | GGAATAACCCatgtcagaacgtttc | 5' UTR region and beginning of coding region | Template |
Instructor | Acetate | adhE | AATGCTCTCCTGATAATGTTAAAC | Promoter and 5' UTR region right before coding region | Nontemplate |
M2D5/M2D7: sequencing data
T/R
Team | pgRNA sequencing |
red | files |
orange | files |
yellow | files |
green | files |
blue | files |
pink | files |
purple | files |
white | files |
W/F
Team | pgRNA sequencing |
red | files |
orange | files |
blue | files |