Difference between revisions of "Talk:20.109(F17):Module 2"
From Course Wiki
(→Fermentation product and gene targeted:) |
(→Fermentation product and gene targeted:) |
||
| Line 112: | Line 112: | ||
|Instructor | |Instructor | ||
|Acetate | |Acetate | ||
| − | | | + | |aceEF |
|GGAATAACCCatgtcagaacgtttc | |GGAATAACCCatgtcagaacgtttc | ||
|5' UTR region and beginning of gene | |5' UTR region and beginning of gene | ||
| Line 119: | Line 119: | ||
|Instructor | |Instructor | ||
|Acetate | |Acetate | ||
| − | | | + | |adhE (1) |
|GGAGAGCATTatggctgttactaatg | |GGAGAGCATTatggctgttactaatg | ||
|5' UTR region and beginning of gene | |5' UTR region and beginning of gene | ||
| Line 126: | Line 126: | ||
|Instructor | |Instructor | ||
|Acetate | |Acetate | ||
| − | | | + | |adhE (2) |
|AATGCTCTCCTGATAATGTTAAAC | |AATGCTCTCCTGATAATGTTAAAC | ||
|Promoter and 5' UTR region right before start of gene | |Promoter and 5' UTR region right before start of gene | ||
Revision as of 17:37, 7 November 2017
Contents
Fermentation product and gene targeted:
T/R
| Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
| red | Acetate | adhE | TTAACGCACTCGTAGAGCGTGTAAA | beginning of coding region | |
| orange | Ethanol | pta-ack | CTATGGCTCCCTGACGTTTT | ||
| yellow | Ethanol | frdA | GCTGTGGGATAAAAACAATCTGGAG | minus 35 region | template strand |
| green | E | LdhA | ttgtgctataaacggcgagtttcat | ||
| blue | E | pta | ttcacgacaacgttcaataatcat | ||
| pink | Acetate | adhE | TTACTAAAAAAGTTTAACATTATCA | promoter region | template strand |
| purple | Acetate | adhE | TTTACTAAAAAAGTTTAACATTATC | ' -35 region' | 'template' |
| white | Acetate | adhE | CTGATAATGTTAAACTTTTT | promoter | non-template strand |
W/F
| Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
| red | Ethanol | ack (indirectly, pta) | GTTTTTTTAGCCACGTATCAATTAT | promoter region of ack | Nontemplate strand |
| orange | Ethanol | ldhA | ATTCAACATCACTGGAGAAAGTCTT | promoter | template |
| blue | Ethanol | ackA | TTTTTAGCCACGTATCAATTAT | promoter region of ackA, starting at -32 | nontemplate |
Instructor Data
| Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
| Instructor | Acetate | aceEF | GGAATAACCCatgtcagaacgtttc | 5' UTR region and beginning of gene | Template |
| Instructor | Acetate | adhE (1) | GGAGAGCATTatggctgttactaatg | 5' UTR region and beginning of gene | Template |
| Instructor | Acetate | adhE (2) | AATGCTCTCCTGATAATGTTAAAC | Promoter and 5' UTR region right before start of gene | Nontemplate |
M2D5/M2D7: sequencing data
T/R
| Team | pgRNA sequencing |
| red | files |
| orange | files |
| yellow | files |
| green | files |
| blue | files |
| pink | files |
| purple | files |
| white | files |
W/F
| Team | pgRNA sequencing |
| red | files |
| orange | files |
| blue | files |
