Difference between revisions of "Talk:20.109(F17):Module 2"
From Course Wiki
(→M2D5/M2D7: sequencing data) |
|||
| Line 106: | Line 106: | ||
|'''Team''' | |'''Team''' | ||
|'''pgRNA sequencing''' | |'''pgRNA sequencing''' | ||
| + | |- | ||
| + | |red | ||
| + | |[[Media:TR Yellow.zip| files]] | ||
| + | |- | ||
| + | |orange | ||
| + | |[[Media:TR Yellow.zip| files]] | ||
|- | |- | ||
|yellow | |yellow | ||
| Line 121: | Line 127: | ||
|purple | |purple | ||
|[[Media:TR Purple.zip| files]] | |[[Media:TR Purple.zip| files]] | ||
| + | |- | ||
| + | |white | ||
| + | |[[Media:TR Pink.zip| files]] | ||
| + | |- | ||
|} | |} | ||
| Line 132: | Line 142: | ||
|[[Media:WFred_sequencing.zip| files]] | |[[Media:WFred_sequencing.zip| files]] | ||
|- | |- | ||
| − | | | + | |orange |
|[[Media:WFgreen_sequencing.zip| files]] | |[[Media:WFgreen_sequencing.zip| files]] | ||
|- | |- | ||
| Line 141: | Line 151: | ||
|[[Media:WFpurple_sequencing.zip| files]] | |[[Media:WFpurple_sequencing.zip| files]] | ||
|- | |- | ||
| − | |||
| − | |||
| − | |||
| − | |||
| − | |||
|} | |} | ||
Revision as of 14:44, 2 November 2017
Contents
Fermentation product and gene targeted:
T/R
| Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
| red | Acetate | adhE | TTAACGCACTCGTAGAGCGTGTAAA | ||
| orange | Ethanol | pta-ack | CTATGGCTCCCTGACGTTTT | ||
| yellow | Ethanol | frdA | GCTGTGGGATAAAAACAATCTGGAG | ||
| green | E | LdhA | ttgtgctataaacggcgagtttcat | ||
| blue | E | pta | ttcacgacaacgttcaataatcat | ||
| pink | Acetate | adhE | TTACTAAAAAAGTTTAACATTATCA | ||
| purple | Acetate | adhE | TTTACTAAAAAAGTTTAACATTATC | ||
| white | Acetate | adhE | CTGATAATGTTAAACTTTTT |
W/F
| Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand |
| red | Ethanol | ack (indirectly, pta) | GTTTTTTTAGCCACGTATCAATTAT | ||
| orange | Ethanol | ldhA | ATTCAACATCACTGGAGAAAGTCTT | ||
| blue | Ethanol | ackA | TTTTTAGCCACGTATCAATTAT |
M2D5/M2D7: sequencing data
T/R
| Team | pgRNA sequencing |
| red | files |
| orange | files |
| yellow | files |
| green | files |
| blue | files |
| pink | files |
| purple | files |
| white | files |
W/F
| Team | pgRNA sequencing |
| red | files |
| orange | files |
| blue | files |
| purple | files |
