Difference between revisions of "20.109(S22):Class data"

From Course Wiki
Jump to: navigation, search
(sgRNA_target sequences)
 
(56 intermediate revisions by 24 users not shown)
Line 135: Line 135:
  
 
[[https://www.dropbox.com/sh/mjbmi36a644vj2r/AADvWZHEhzAf6wewHWG3MIIga?dl=0 T/R diagnostic digest folder ]]
 
[[https://www.dropbox.com/sh/mjbmi36a644vj2r/AADvWZHEhzAf6wewHWG3MIIga?dl=0 T/R diagnostic digest folder ]]
 +
<br>
 +
[[https://www.dropbox.com/sh/yha069myv9o4vez/AADLNuCzilifSufHWlmqjb-ga?dl=0 W/F Diagnostic Digest Folder]]
  
 
===sgRNA_target sequences===
 
===sgRNA_target sequences===
Line 155: Line 157:
 
| beginning of gene
 
| beginning of gene
 
| target coding strand
 
| target coding strand
|
+
| https://www.dropbox.com/scl/fi/im2nky48dz8dninn07pwk/TR_red_yield.xlsx?dl=0&rlkey=yhbf2t0sxdfmqxqkrrpc8hkah
 
|-
 
|-
 
| TR Orange
 
| TR Orange
 
| Ethanol (E)
 
| Ethanol (E)
 +
| ''gltA''
 
| gaacacaccttttgaaccgagagta
 
| gaacacaccttttgaaccgagagta
| gltA
 
 
| beginning of gene
 
| beginning of gene
 
| target coding strand
 
| target coding strand
|  
+
| [[Media:TR Orange.xlsx | orange data]]
|  
+
 
|-
 
|-
 
| TR Yellow
 
| TR Yellow
Line 172: Line 173:
 
| -35 region  
 
| -35 region  
 
| noncoding strand
 
| noncoding strand
|  
+
| https://1drv.ms/x/s!AvcscE3syv-CgQfF_d8w80nc90RM
|
+
|
+
|
+
|
+
 
|-
 
|-
 
| TR Green
 
| TR Green
Line 184: Line 181:
 
| -30 region
 
| -30 region
 
| coding strand
 
| coding strand
|
+
| https://www.dropbox.com/scl/fi/yr9yndhh1h3hp8z8x0upf/TRGreen_M2D6Analysis.xlsx?dl=0&rlkey=3szzyw9psr0wqh1jdkroc7h6p
 
|-
 
|-
 
| TR Blue
 
| TR Blue
Line 192: Line 189:
 
| beginning of gene
 
| beginning of gene
 
| coding strand
 
| coding strand
|  
+
| https://www.dropbox.com/s/cxxrl6zmj2ckeiy/TR_Blue_M2D6_Acetate_Data.xlsx?dl=0
 
|-
 
|-
 
| TR Teal
 
| TR Teal
Line 200: Line 197:
 
| beginning of gene
 
| beginning of gene
 
| coding strand
 
| coding strand
|
+
| https://www.dropbox.com/scl/fi/yic9bw46ltim14xbxudwk/TR-Teal-M2D6_data_analysis.xlsx?dl=0&rlkey=z62dl8p8a4sanabelbrh3lgpn
 
|-
 
|-
 
| TR Pink
 
| TR Pink
Line 215: Line 212:
 
| GTAGGGATCAGCATAATAATAC
 
| GTAGGGATCAGCATAATAATAC
 
| beginning of gene
 
| beginning of gene
| non-template strand
+
| coding (non-template) strand
|  
+
| https://mitprod-my.sharepoint.com/:x:/g/personal/alpusey_mit_edu/ET0pYqoAsbdMjiX3Kg8mItEB0BjTW_gz-6u_At07MqQxPw?e=MBvZ1U
 +
 
 
|-
 
|-
 
| TR Grey
 
| TR Grey
Line 224: Line 222:
 
| beginning of gene
 
| beginning of gene
 
| noncoding strand
 
| noncoding strand
|  
+
| https://docs.google.com/spreadsheets/d/15mpS30zxthBy3nxzGolYUSkcbeGWi7QR/edit?usp=sharing&ouid=116057108253329472008&rtpof=true&sd=true
|
+
|
+
|
+
|
+
 
|-
 
|-
 
| TR White
 
| TR White
Line 236: Line 230:
 
| beginning of gene
 
| beginning of gene
 
| targeting the coding strand (Non template)
 
| targeting the coding strand (Non template)
|
+
|https://www.dropbox.com/scl/fi/68akhe3zajc3gmvjlr40m/TR-White-Ethanol-Yield-Results.xlsx?dl=0&rlkey=cs9i029pdq8hyk2vuq6g3y3lb
 
|}
 
|}
  
Line 251: Line 245:
 
|-
 
|-
 
| WF Red
 
| WF Red
|  
+
| Ethanol (E)
|  
+
| pta
|  
+
| gaccgacgctggttccggta
|  
+
| Beginning of coding sequence of gene
|  
+
| Coding
 
|
 
|
 +
https://mitprod-my.sharepoint.com/:x:/g/personal/mrowlett_mit_edu/EaRFR7TFOmhIucZzlLJylLwBfwhJs1lEEHUaMS5HK2YGdw?e=GpiHf9
 
|-
 
|-
 
| WF Orange
 
| WF Orange
|  
+
| Ethanol (E)
|  
+
| pta
|  
+
| ttcgtagttcagagactgggcaaac
|  
+
| beginning of gene
|  
+
| coding
|
+
|https://www.dropbox.com/s/e2glkl89k0e3n0j/WFOrangeEthanolAssay.xlsx?dl=0
 
|-
 
|-
 
| WF Yellow
 
| WF Yellow
|  
+
|Ethanol (E)
|  
+
|ppc
|  
+
|CATTGCGTAGTAATGTCAGTATGC
|  
+
|beginning of gene
|
+
|non-coding strand (template)
|
+
|https://www.dropbox.com/s/oceuj929siygv6l/Sp22_M2D6_data_analysis_template.xlsx?dl=0
 
|-
 
|-
 
| WF Green
 
| WF Green
|
+
|Acetate (A)
|  
+
|ppc
|  
+
|CCCCAGACACCCCATCTTATCGTTT
|  
+
|promoter
|  
+
|coding strand (non template)
|
+
|https://www.dropbox.com/s/yuajy4wjev9ejnn/Sp22_M2D6_data_analysis_template.xlsx?dl=0
 
|-
 
|-
 
| WF Blue
 
| WF Blue
|  
+
| Acetate (A)
|  
+
| adhE
|  
+
| ttcagcgacattagtaacagcc
|  
+
| beginning of the gene
|  
+
| coding strand (non-template)
|  
+
| https://www.dropbox.com/s/xfhwywkx9q81dfm/WFBlue_M2D6_data_analysis_template.xlsx?dl=0
 
|-
 
|-
 
| WF Teal
 
| WF Teal
Line 299: Line 294:
 
|-
 
|-
 
| WF Pink
 
| WF Pink
|  
+
| Ethanol (E)
|  
+
| ldhA
|  
+
| GTGATGTTGAATCACATTTAAGC
|  
+
| -35
|  
+
| conding strand (non-template)
|
+
|https://mitprod-my.sharepoint.com/:x:/g/personal/skykim_mit_edu/EVo2U1bwZYVMrI-QhOeU--YBpYk0ul4F-H-o2qfISl6Lkg?e=ht6H12
 
|-
 
|-
 
| WF Purple
 
| WF Purple
|  
+
| Acetate (A)
|  
+
| adhE
|  
+
| gttcagcgacattagtaacagccat
|  
+
| beginning of gene
|  
+
| coding strand (non-template)
|  
+
| https://mitprod-my.sharepoint.com/:x:/g/personal/sabrliu_mit_edu/EQLNILyBeihNsubxjolVF24BT-TTYja33Pdp7lkFifthTw?e=kqYsM8
 
|-
 
|-
 
| WF Grey
 
| WF Grey
Line 323: Line 318:
 
|-
 
|-
 
| WF White
 
| WF White
|  
+
| Acetate (A)
|  
+
| adhE
|  
+
| ACAATTTATTAACTGTTAGCTATAA
|  
+
| promoter (-10)
|  
+
| non-coding strand (template)
|
+
|https://www.dropbox.com/scl/fi/a2u9gahr8lhvhxipvdj7x/White-Acetate-Data.xlsx?dl=0&rlkey=ow2gefah5hczpy3p8rb03efol
 
|}
 
|}
 +
 +
====Sequencing Data====
 +
 +
[[https://www.dropbox.com/sh/jw3s2fmml3iux60/AACw-y8-uHnU_NnxoSDpTACla?dl=0 T/R sequencing files]]
 +
[[https://www.dropbox.com/sh/e83l1nk3r1y8o1h/AAASE11ULHNVBuBfe42iXs1Wa?dl=0 W/F sequencing files]]

Latest revision as of 18:20, 6 May 2022

20.109(S22): Laboratory Fundamentals of Biological Engineering

Sp17 20.109 M1D7 chemical structure features.png

Spring 2022 schedule        FYI        Assignments        Homework        Class data        Communication        Accessibility

       M1: Drug discovery        M2: Metabolic engineering        M3: Project design       


Module 1: Drug discovery

SDS-PAGE gel images

[SDS-PAGE dropbox folder]

small molecule selections

T/R

Team small molecule #1 (enter compound ID) small molecule #2 (enter compound ID) aggregation assay results
TR Red 83079118 69269200 https://www.dropbox.com/s/7eut5ymxmiel9rp/TR_teal_red.xlsx?dl=0
TR Orange 95877382 83023303 https://docs.google.com/spreadsheets/d/1Lr5QAYY-63bOfrxuzZh1hgpHfTkCcTuU/edit?usp=sharing&ouid=103020115084669070409&rtpof=true&sd=true
TR Yellow 69269200 83079118 https://www.dropbox.com/s/ssc6b9kp7h6s7zj/20.109%20T%3AR%20Yellow%20Team%20Aggregation%20Assay%20-%20Class%20Data.xlsx?dl=0
TR Green 69269200 83079118 https://www.dropbox.com/s/fzo02lfzgo5ujwk/20109_TR_Green_Aggregation_Assay_Data.pptx?dl=0
TR Blue 69269200 83079118 https://www.dropbox.com/s/ezfjb4xt84xv59e/TR_blue.xlsx?dl=0
TR Teal 69269200 83079118 https://www.dropbox.com/scl/fi/1cs77ilahj51l51cw0j2g/TR_Teal_83079119.xlsx?dl=0&rlkey=8l1cae481k6p7p5y8290e8pu2
TR Pink 69269200 83079118
TR Purple 69269200 83079118 https://www.dropbox.com/s/lsdcuxv3y863k3z/TR_purple%20aggregation%20results.xlsx?dl=0
TR Grey 69269200 83079118 https://docs.google.com/spreadsheets/d/12ZOkOtndcb5FXAd1vvHBD4weM_FrWICbkfcykoFhrGY/edit?usp=sharing
TR White 69269200 83079118 https://www.dropbox.com/scl/fi/8x98j2r2nfq2qgwr4eura/White-Team-Aggregation-Results.xlsx?dl=0&rlkey=varbpxlx0apo8b2zkdt4kbxev

W/F

Team small molecule #1 (enter compound ID) small molecule #2 (enter compound ID) aggregation assay results
WF Red 69269200 83079118 https://mitprod-my.sharepoint.com/:x:/g/personal/mrowlett_mit_edu/EXXtvBLjG9BLtZajiE1PqbUBBkSUVd5xolqzA2KO1u1ADg?e=JjooPh
WF Orange 83079118 69269200 https://www.dropbox.com/s/8ksmmtml3e673m5/WFOrange%20Aggregation%20Assay%20Data.xlsx?dl=0
WF Yellow 83079118 69269200 https://www.dropbox.com/scl/fi/cotyaashmbv0vrz7wfral/Aggregation-Analysis.xlsx?dl=0&rlkey=r3r8isia4mk6vmy29a5usdykq
WF Green 83079118 83023303 https://www.dropbox.com/s/u38arbolq8zn3xq/20220218_agg_assay_yellow_green%202.xlsx?dl=0
WF Blue 69269200 83079118 https://www.dropbox.com/scl/fi/zogoszln7ydo10em8b196/20220218_agg_assay_blue-83079118.xlsx?dl=0&rlkey=glixenu1uqfo6xa5t1fmvmi08
WF Pink 83079118 69269200 https://docs.google.com/spreadsheets/d/13URd1atEq8Aqa6Ur_RrGyESe3g_RDVHK/edit?usp=sharing&ouid=107012858600740729039&rtpof=true&sd=true
WF Purple 69269200 83079118 https://docs.google.com/spreadsheets/d/1WXBr83b12vb83pYv1bqTUPl5VGFIDap9uOjESwOH0tQ/edit?usp=sharing
WF White 69269200 83023303 https://www.dropbox.com/s/c2g5513td5fepee/Aggregation%20Data.xlsx?dl=0

Aggregation Results

[T/R Aggregation dropbox folder]


Localization Results

[Localization Dropbox folder]

Module 2: Metabolic engineering

Diagnostic Digest gels

[T/R diagnostic digest folder ]
[W/F Diagnostic Digest Folder]

sgRNA_target sequences

T/R

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA (DNA) sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target coding or non-coding strand Ethanol / Acetate Assay Results
TR Red Acetate (A) aceE gagtttcgatcggatccacgtcatt beginning of gene target coding strand https://www.dropbox.com/scl/fi/im2nky48dz8dninn07pwk/TR_red_yield.xlsx?dl=0&rlkey=yhbf2t0sxdfmqxqkrrpc8hkah
TR Orange Ethanol (E) gltA gaacacaccttttgaaccgagagta beginning of gene target coding strand orange data
TR Yellow Ethanol (E) pta-ack GTTTTTTTAGCCACGTATCAATTAT -35 region noncoding strand https://1drv.ms/x/s!AvcscE3syv-CgQfF_d8w80nc90RM
TR Green Ethanol (E) aceE TTATTCCTTATCTATCTAATAACGT -30 region coding strand https://www.dropbox.com/scl/fi/yr9yndhh1h3hp8z8x0upf/TRGreen_M2D6Analysis.xlsx?dl=0&rlkey=3szzyw9psr0wqh1jdkroc7h6p
TR Blue Acetate aceE GTCGCGAGTTTCGATCGGATCCACG beginning of gene coding strand https://www.dropbox.com/s/cxxrl6zmj2ckeiy/TR_Blue_M2D6_Acetate_Data.xlsx?dl=0
TR Teal Acetate aceE CGTCATTTGGGAAACGTTCT beginning of gene coding strand https://www.dropbox.com/scl/fi/yic9bw46ltim14xbxudwk/TR-Teal-M2D6_data_analysis.xlsx?dl=0&rlkey=z62dl8p8a4sanabelbrh3lgpn
TR Pink
TR Purple Ethanol pta GTAGGGATCAGCATAATAATAC beginning of gene coding (non-template) strand https://mitprod-my.sharepoint.com/:x:/g/personal/alpusey_mit_edu/ET0pYqoAsbdMjiX3Kg8mItEB0BjTW_gz-6u_At07MqQxPw?e=MBvZ1U
TR Grey Ethanol aceE CGTCATTTGGGAAACGTTCTGACAT beginning of gene noncoding strand https://docs.google.com/spreadsheets/d/15mpS30zxthBy3nxzGolYUSkcbeGWi7QR/edit?usp=sharing&ouid=116057108253329472008&rtpof=true&sd=true
TR White Ethanol aceE AGTTTCGATCGGATCCACGTCATTT beginning of gene targeting the coding strand (Non template) https://www.dropbox.com/scl/fi/68akhe3zajc3gmvjlr40m/TR-White-Ethanol-Yield-Results.xlsx?dl=0&rlkey=cs9i029pdq8hyk2vuq6g3y3lb

W/F

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA (DNA) sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target coding or non-coding strand Colorimetric Assay Results
WF Red Ethanol (E) pta gaccgacgctggttccggta Beginning of coding sequence of gene Coding

https://mitprod-my.sharepoint.com/:x:/g/personal/mrowlett_mit_edu/EaRFR7TFOmhIucZzlLJylLwBfwhJs1lEEHUaMS5HK2YGdw?e=GpiHf9

WF Orange Ethanol (E) pta ttcgtagttcagagactgggcaaac beginning of gene coding https://www.dropbox.com/s/e2glkl89k0e3n0j/WFOrangeEthanolAssay.xlsx?dl=0
WF Yellow Ethanol (E) ppc CATTGCGTAGTAATGTCAGTATGC beginning of gene non-coding strand (template) https://www.dropbox.com/s/oceuj929siygv6l/Sp22_M2D6_data_analysis_template.xlsx?dl=0
WF Green Acetate (A) ppc CCCCAGACACCCCATCTTATCGTTT promoter coding strand (non template) https://www.dropbox.com/s/yuajy4wjev9ejnn/Sp22_M2D6_data_analysis_template.xlsx?dl=0
WF Blue Acetate (A) adhE ttcagcgacattagtaacagcc beginning of the gene coding strand (non-template) https://www.dropbox.com/s/xfhwywkx9q81dfm/WFBlue_M2D6_data_analysis_template.xlsx?dl=0
WF Teal
WF Pink Ethanol (E) ldhA GTGATGTTGAATCACATTTAAGC -35 conding strand (non-template) https://mitprod-my.sharepoint.com/:x:/g/personal/skykim_mit_edu/EVo2U1bwZYVMrI-QhOeU--YBpYk0ul4F-H-o2qfISl6Lkg?e=ht6H12
WF Purple Acetate (A) adhE gttcagcgacattagtaacagccat beginning of gene coding strand (non-template) https://mitprod-my.sharepoint.com/:x:/g/personal/sabrliu_mit_edu/EQLNILyBeihNsubxjolVF24BT-TTYja33Pdp7lkFifthTw?e=kqYsM8
WF Grey
WF White Acetate (A) adhE ACAATTTATTAACTGTTAGCTATAA promoter (-10) non-coding strand (template) https://www.dropbox.com/scl/fi/a2u9gahr8lhvhxipvdj7x/White-Acetate-Data.xlsx?dl=0&rlkey=ow2gefah5hczpy3p8rb03efol

Sequencing Data

[T/R sequencing files]

[W/F sequencing files]