Difference between revisions of "20.109(S18):Class data"
(→Battery Capacity Measurements) |
(→T/R Battery Information) |
||
(38 intermediate revisions by 17 users not shown) | |||
Line 450: | Line 450: | ||
==Module 3: Engineering biomaterials== | ==Module 3: Engineering biomaterials== | ||
− | === | + | ===TEM & EDX Images=== |
− | [[Media:Sp18_GoldStandard.zip|Gold standard images]]<br> | + | [[Media:Sp18_GoldStandard.zip|Gold standard images--only one set taken for the whole class to use]]<br> |
===Battery Capacity Measurements=== | ===Battery Capacity Measurements=== | ||
− | + | Please use data that were sent to you via email. | |
===T/R Battery Information=== | ===T/R Battery Information=== | ||
Line 466: | Line 466: | ||
|red | |red | ||
|5nm gold, 25 per phage | |5nm gold, 25 per phage | ||
− | | | + | |3.06 |
− | | | + | |108.81 |
|- | |- | ||
|orange | |orange | ||
− | |3.8nm gold, | + | |3.8nm gold, 60 per phage |
− | | | + | |4.7 |
− | | | + | |81.4 |
|- | |- | ||
|yellow | |yellow | ||
|9nm gold, 5 per phage | |9nm gold, 5 per phage | ||
− | | | + | |2.54 |
− | | | + | |130.50 |
|- | |- | ||
|green | |green | ||
|9nm gold, 7 per phage | |9nm gold, 7 per phage | ||
− | | | + | |2.50 |
− | | | + | |47.2 |
|- | |- | ||
|blue | |blue | ||
|9nm gold, 15 per phage | |9nm gold, 15 per phage | ||
− | | | + | |3.74 |
− | | | + | |78.83 |
|- | |- | ||
|pink | |pink | ||
Line 496: | Line 496: | ||
|purple | |purple | ||
|3.8nm gold, 60 per phage | |3.8nm gold, 60 per phage | ||
− | | | + | |3.24 |
− | | | + | |91.45 |
|- | |- | ||
|gray | |gray | ||
|5nm gold, 60 per phage | |5nm gold, 60 per phage | ||
− | | | + | |2.91 |
| | | | ||
|- | |- | ||
|white | |white | ||
− | | | + | |5nm gold, ~60 per phage |
− | | | + | |3.17 |
− | | | + | | 111.33 |
|} | |} | ||
<br> | <br> | ||
Line 516: | Line 516: | ||
|- | |- | ||
|red | |red | ||
− | | | + | |3.43 |
− | | | + | |96.64 |
|- | |- | ||
|orange | |orange | ||
− | | | + | |1.29 |
− | | | + | |87.4 |
|- | |- | ||
|yellow | |yellow | ||
− | | | + | |2.98 |
− | | | + | |60.28 |
|- | |- | ||
|green | |green | ||
− | | | + | |3.47 |
− | | | + | |46.69 |
|- | |- | ||
|blue | |blue | ||
− | | | + | |3.05 |
− | | | + | |58.43 |
|- | |- | ||
|pink | |pink | ||
Line 540: | Line 540: | ||
|- | |- | ||
|purple | |purple | ||
− | | | + | |2.27 |
− | | | + | |62.98 |
|- | |- | ||
|gray | |gray | ||
− | | | + | |2.12 |
| | | | ||
|- | |- | ||
Line 553: | Line 553: | ||
<br> | <br> | ||
<br> | <br> | ||
+ | |||
===W/F Battery Information=== | ===W/F Battery Information=== | ||
{| border=1px | {| border=1px | ||
Line 561: | Line 562: | ||
|- | |- | ||
|red | |red | ||
− | | | + | |9nm, 20 per phage |
| | | | ||
| | | | ||
|- | |- | ||
|orange | |orange | ||
− | | | + | |5nm, 17 per phage |
| | | | ||
| | | | ||
|- | |- | ||
|green | |green | ||
− | | | + | |5nm, 30 per phage |
− | | | + | |N/A |
− | | | + | |N/A |
|- | |- | ||
|blue | |blue | ||
− | | | + | |3.8nm, 30 per phage; 5nm, 10 per phage |
− | | | + | |N/A |
− | | | + | |N/A |
|- | |- | ||
|pink | |pink | ||
− | | | + | |9nm, 17 per phage |
− | | | + | |N/A |
− | | | + | |N/A |
|- | |- | ||
|purple | |purple | ||
− | | | + | |5nm, 18 per phage |
− | | | + | |3.005 |
− | | | + | |38.30269 |
|- | |- | ||
|platinum | |platinum | ||
− | | | + | |3.8nm, 20 per phage; 5nm, 12 per phage; 9nm, 8 per phage |
− | | | + | |N/A |
− | | | + | |N/A |
|} | |} | ||
<br> | <br> | ||
Line 602: | Line 603: | ||
|- | |- | ||
|red | |red | ||
− | | | + | |3.34 |
− | | | + | |86.38279 |
|- | |- | ||
|orange | |orange | ||
− | | | + | |2.76 |
− | | | + | |106.6828 |
|- | |- | ||
|green | |green | ||
Line 618: | Line 619: | ||
|- | |- | ||
|pink | |pink | ||
− | | | + | |3.91 |
− | | | + | |99.46007 |
|- | |- | ||
|purple | |purple | ||
Line 626: | Line 627: | ||
|- | |- | ||
|platinum | |platinum | ||
− | | | + | |2.98 |
− | | | + | |37.91946 |
|} | |} |
Latest revision as of 10:06, 14 May 2018
Contents
Module 1: Assessing ligand binding
M1D2: SMM analysis
GAL files linked here.
Scan images and set numbers assigned to each team:
Team | Slide #1 | Slide #2 |
T/R | ||
Red | 14399983, set 1 | 14400077, set 4 |
Orange | 14400113, set 2 | 14400139, set 3 |
Yellow | 14400114, set 2 | 14400140, set 3 |
Green | 14399984, set 5 | 14399988, set 6 |
Blue | 14400072, set 5 | 14399987, set 6 |
Pink | 14399983, set 1 | 14400128, set 7 |
Purple | 14400077, set 4 | 14399959, set 8 |
White | 14400129, set 7 | 14400081, set 9 |
Grey | 14400128, set 7 | 14399959, set 8 |
W/F | ||
Red | 14400129, set 7 | 14400081, set 9 |
Orange | 14400128, set 7 | 14399959, set 8 |
Green | 14400143, set 11 | 14399950, set 12 |
Blue | 14400147, set 10 | 14399951, set 12 |
Pink | 14400146, set 10 | 14399947, set 11 |
Purple | 14399983, set 1 | 14400077, set 4 |
White | 14400113, set 2 | 14400139, set 3 |
Chosen Compounds
List of Chosen Compounds
List of Compounds with SMILES
List of Compounds with SMILES and Teams
M1D4: Protein Gel Images
Team | gel image | |
T/R | ||
Red | Sp18_TRred | |
Orange | Sp18_TRorange | |
Yellow | Sp18_TRyellow | |
Green | Sp18_TRgreen | |
Blue | Sp18_TRblue | |
Pink | Sp18_TRpink | |
Purple | Sp18_TRpurple | |
White | Sp18_TRwhite | |
Grey | Sp18_TRgrey | |
W/F | ||
Red | Sp18_WFred | |
Orange | Sp18_WForange | |
Green | Sp18_WFgreen | |
Blue | Sp18_WFblue | |
Pink | Sp18_WFpink | |
Purple | Sp18_WFpurple | |
Gray | Sp18_WFgray |
M1D5: PPIase Assay Results
TR Raw Data
Sp18_PPIase_TR_Run1
Sp18_PPIase_TR_Run2
Sp18_PPIase_TR_Run3
WF Raw Data
Sp18_PPIase_WF_Run1
Sp18_PPIase_WF_Run2
Sp18_PPIase_WF_Run3
Pooled PPIase Data
TR & WF pooled Conditions #1, #2, #3, #6, and #7
Team | PPIase Assay Results | |
T/R | ||
Red | Sp18_TRred_PPIase | |
Orange | Sp18_TRorange_PPIase | |
Yellow | Sp18_TRyellow_PPIase | |
Green | Sp18_TRgreen_PPIase | |
Blue | Sp18_TRblue_PPIase | |
Pink | Sp18_TRpink_PPIase | |
Purple | Sp18_TRpurple_PPIase | |
White | Sp18_TRwhite_PPIase | |
Grey | Sp18_TRgrey_PPIase | |
W/F | ||
Red | Sp18_WFred_PPIase | |
Orange | Sp18_WForange_PPIase | |
Green | Sp18_WFgreen_PPIase | |
Blue | Sp18_WFblue_PPIase | |
Pink | Sp18_WFpink_PPIase | |
Purple | Sp18_WFpurple_PPIase | |
Gray | Sp18_WFgray_PPIase |
M1D6: DSF Assay Results
Rapamycin Concentrations
TR DSF Raw Data
Sp18_TR_DSF_PlateMap
Sp18_TR_FKBP12_Melt Curve RFU Results
Sp18_TR_FKBP12_Melt Curve Derivative Results
WF DSF Raw Data
Sp18_WF_DSF_PlateMap
Sp18_WF_FKBP12_Melt Curve RFU Results
Sp18_WF_FKBP12_Melt Curve Derivative Results
Excel file combining DSF derivative data FKBP12 with different concentrations of Rapamycin
Team | DSF Assay Results | |
T/R | ||
Red | Sp18_TRred_DSF | |
Orange | Sp18_TRorange_DSF | |
Yellow | Sp18_TRyellow_DSF | |
Green | Sp18_TRgreen_DSF. | |
Blue | Sp18_TRblue_DSF. | |
Pink | Sp18_TRpink_DSF | |
Purple | Sp18_TRpurple_DSF | |
White | Sp18_TRwhite_DSF | |
Grey | Sp18_TRgrey_DSF | |
W/F | ||
Red | Sp18_WFred_DSF | |
Orange | Sp18_WForange_DSF | |
Green | Sp18_WFgreen_DSF | |
Blue | Sp18_WFblue_DSF | |
Pink | Sp18_WFpink_DSF | |
Purple | Sp18_WFpurple_DSF | |
Gray | Sp18_WFgray_DSF |
Module 2: Measuring gene expression
Team | qPCR Results | Melt Curve Derivative |
T/R | ||
Red | Sp18_TRred_qPCR | Sp18_TRred_Tm.jpg |
Orange | Sp18_TRorange_qPCR | Sp18_TRorange_Tm.jpg |
Yellow | Sp18_TRyellow_qPCR | Sp18_TRyellow_Tm.jpg |
Green | Sp18_TRgreen_qPCR | Sp18_TRgreen_Tm.jpg |
Blue | Sp18_TRblue_qPCR | Sp18_TRblue_Tm.jpg |
Pink | Sp18_TRpink_qPCR | Sp18_TRpink_Tm.jpg |
Purple | Sp18_TRpurple_qPCR | Sp18_TRpurple_Tm.jpg |
White | Sp18_TRwhite_qPCR | Sp18_TRwhite_Tm.jpg |
Grey | Sp18_TRgrey_qPCR | Sp18_TRgrey_Tm.jpg |
W/F | ||
Red | Sp18_WFred_qPCR | Sp18_WFred_Tm.jpg |
Orange | Sp18_WForange_qPCR | Sp18_WForange_Tm.jpg |
Green | Sp18_WFgreen_qPCR | Sp18_WFgreen_Tm.jpg |
Blue | Sp18_WFblue_qPCR | Sp18_WFblue_Tm.jpg |
Pink | Sp18_WFpink_qPCR | Sp18_WFpink_Tm.jpg |
Purple | Sp18_WFpurple_qPCR | Sp18_WFpurple_Tm.jpg |
Gray | Sp18_WFplatinum_qPCR | Sp18_WFplatinum_Tm.jpg |
Teams | qPCR p21 Forward Primer Sequence | qPCR p21 Reverse Primer Sequence |
T/R | ||
Red, Green, Blue, Purple | AGTCAGTTCCTTGTGGAGCC | GACATGGCGCCTCCTCTG |
Orange, Yellow, White | GCCGAAGTCAGTTCCTTGTG | TTCTGACATGGCGCCTCCT |
Pink | GTCAGTTCCTTGTGGAGCCG | ATGGCGCCTCCTCTGAGT |
Gray | GCTGCCGAAGTCAGTTCCTT | TTCTGACATGGCGCCTCC |
W/F | ||
Red | CCAGCATGACAGATTTCTACCAC | CTTCCTGTGGGCGGATTAGG |
Orange, Pink, Purple, Platinum | GCAGACCAGCATGACAGATTTC | ATGTAGAGCGGGCCTTTGAG |
Green, Blue | GGCAGACCAGCATGACAGATTT | AGATGTAGAGCGGGCCTTTG |
M2D9 Cell viability data
Sp18 TR Cell Titer Glo Data
Sp18 WF Cell Titer Glo Data
Module 3: Engineering biomaterials
TEM & EDX Images
Gold standard images--only one set taken for the whole class to use
Battery Capacity Measurements
Please use data that were sent to you via email.
T/R Battery Information
Team | Experimental battery composition | Weight of cathode (mg) | Actual capacity (mA*h/g) |
red | 5nm gold, 25 per phage | 3.06 | 108.81 |
orange | 3.8nm gold, 60 per phage | 4.7 | 81.4 |
yellow | 9nm gold, 5 per phage | 2.54 | 130.50 |
green | 9nm gold, 7 per phage | 2.50 | 47.2 |
blue | 9nm gold, 15 per phage | 3.74 | 78.83 |
pink | 3.8nm gold, 60 per phage | ||
purple | 3.8nm gold, 60 per phage | 3.24 | 91.45 |
gray | 5nm gold, 60 per phage | 2.91 | |
white | 5nm gold, ~60 per phage | 3.17 | 111.33 |
Team | Gold standard battery weight of cathode (mg) | Actual capacity (mA*h/g) |
red | 3.43 | 96.64 |
orange | 1.29 | 87.4 |
yellow | 2.98 | 60.28 |
green | 3.47 | 46.69 |
blue | 3.05 | 58.43 |
pink | ||
purple | 2.27 | 62.98 |
gray | 2.12 | |
white |
W/F Battery Information
Team | Experimental battery composition | Weight of cathode (mg) | Actual capacity (mA*h/g) |
red | 9nm, 20 per phage | ||
orange | 5nm, 17 per phage | ||
green | 5nm, 30 per phage | N/A | N/A |
blue | 3.8nm, 30 per phage; 5nm, 10 per phage | N/A | N/A |
pink | 9nm, 17 per phage | N/A | N/A |
purple | 5nm, 18 per phage | 3.005 | 38.30269 |
platinum | 3.8nm, 20 per phage; 5nm, 12 per phage; 9nm, 8 per phage | N/A | N/A |
Team | Gold standard battery weight of cathode (mg) | Actual capacity (mA*h/g) |
red | 3.34 | 86.38279 |
orange | 2.76 | 106.6828 |
green | ||
blue | ||
pink | 3.91 | 99.46007 |
purple | ||
platinum | 2.98 | 37.91946 |