Difference between revisions of "20.109(F18):Class data"

From Course Wiki
Jump to: navigation, search
Line 244: Line 244:
 
|[[Media:Fa18 WF blue.zip| files]]
 
|[[Media:Fa18 WF blue.zip| files]]
 
|-
 
|-
 +
|}
 +
 +
=Module 3=
 +
 +
===No gold battery data===
 +
 +
 +
===TR Battery information===
 +
{| border=1px
 +
|'''Team'''
 +
|'''Experimental battery composition (AuNP/phage)'''
 +
|'''Weight of cathode (mg)'''
 +
|'''Actual capacity (mA*h/g)'''
 +
|-
 +
|Red
 +
|
 +
|
 +
|
 +
|-
 +
|Orange
 +
|
 +
|
 +
|
 +
|-
 +
|Green
 +
|
 +
|
 +
|
 +
|-
 +
|Pink
 +
|
 +
|
 +
|
 +
|-
 +
|Purple
 +
|
 +
|
 +
|
 +
|}
 +
 +
===WF Battery information===
 +
{| border=1px
 +
|'''Team'''
 +
|'''Experimental battery composition (AuNP/phage)'''
 +
|'''Weight of cathode (mg)'''
 +
|'''Actual capacity (mA*h/g)'''
 +
|-
 +
|Yellow
 +
|
 +
|
 +
|
 +
|-
 +
|Green
 +
|
 +
|
 +
|
 +
|-
 +
|Blue
 +
|
 +
|
 +
|
 
|}
 
|}

Revision as of 18:43, 3 December 2018

20.109(F18): Laboratory Fundamentals of Biological Engineering

Fa18 20109 banner image.png

Fall 2018 schedule        FYI        Assignments        Homework        Class data        Communication
       1. Measuring genomic instability        2. Modulating metabolism        3. Engineering biomaterials              

Module 1

Cell Loading Data

TR and WF cell loading data

CometChip Data

Team Analyzed Data
T/R red Analyzed CometChip data
T/R orange Analyzed CometChip data
T/R green Analyzed CometChip data
T/R pink Analyzed CometChip data
T/R purple Analyzed CometChip data


Team Analyzed Data
W/F yellow Analyzed CometChip data
W/F green Analyzed CometChip data
W/F blue Analyzed CometChip data
W/F pink Analyzed CometChip data


gamma-H2AX Data

Team Recovery time (min) Raw gamma-H2AX Data Analyzed gamma-H2AX Data
T/R red 30 raw data analyzed data
T/R orange 30 raw data analyzed data
T/R green 30 raw data analyzed data
T/R pink 30 raw data analyzed data
T/R purple 60 raw data analyzed data


Team Recovery time (min) Raw gamma-H2AX Data Analyzed gamma-H2AX Data
W/F yellow 30 raw data analyzed data
W/F green 30 raw data analyzed data
W/F blue 60 raw data analyzed data
W/F pink 30 raw data analyzed data

Module 2

Fermentation product and gene targeted:

T/R

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA (DNA) sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand Colorimetric Assay Results
TR red E pta TGCGCCCGATCAGACTACGACTATC Coding region template File:TRRed ethanol rawdata.xlsx
TR orange E ldhA gttgcaggtacttcttgtcgt 32 bps downstream from start of gene Nontemplate Strand File:TROrange ethanol rawdata.xlsx
TR green A adhE TACTAAAAAAGTTTAACATTATCA locus targeted: -34 upstream (promoter) Template strand File:TRGreen acetate rawdata.xlsx
TR pink A Citrate Synthase (gltA) tgagttttgcttttgtatcagccat Beginning of gene Non-template Strand File:TRPink acetate rawdata.xlsx
TR purple A ldhA TAGTAGCTTAAATGTGATTCAACAT Locus targeted: -40 upstream region (promoter) Non-template strand File:TRPurple acetate rawdata.xlsx

W/F

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA (DNA) sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand Colorimetric Assay Results
WF yellow A adhE ATTCGAGCAGATGATTTACTAAAAA locus targeted: -50 upstream; promoter template strand File:WFyellow Acetate RawData.xlsx
WF green Acetate adhE TTACTAAAAAAGTTTAACATTATCA locus targeted: -35 upstream (promoter) template strand File:WFGreen Acetate RawData.xlsx
WF blue A adhE TTCGAGCAGATGATTTACTAAA locus targeted: -49 upstream (promoter) Template Strand File:WFBlue Acetate RawData.xlsx

gRNA_target Sequencing Results

T/R

Team pgRNA sequencing
red files
orange files
green files
pink files
purple files

W/F

Team pgRNA sequencing
yellow files
green files
blue files

Module 3

No gold battery data

TR Battery information

Team Experimental battery composition (AuNP/phage) Weight of cathode (mg) Actual capacity (mA*h/g)
Red
Orange
Green
Pink
Purple

WF Battery information

Team Experimental battery composition (AuNP/phage) Weight of cathode (mg) Actual capacity (mA*h/g)
Yellow
Green
Blue
Retrieved from "http://engineerbiology.org/w/index.php?title=20.109(F18):Class_data&oldid=40183"