Difference between revisions of "20.109(F18):Class data"

From Course Wiki
Jump to: navigation, search
(Fermentation product and gene targeted:)
(TR Battery information)
 
(41 intermediate revisions by 12 users not shown)
Line 131: Line 131:
 
| pta
 
| pta
 
| TGCGCCCGATCAGACTACGACTATC
 
| TGCGCCCGATCAGACTACGACTATC
| Middle of the operon
+
| Coding region
| Non-template
+
| template
 
|[[File: TRRed_ethanol_rawdata.xlsx | Raw data ]]
 
|[[File: TRRed_ethanol_rawdata.xlsx | Raw data ]]
 
|-
 
|-
Line 140: Line 140:
 
|gttgcaggtacttcttgtcgt
 
|gttgcaggtacttcttgtcgt
 
|32 bps downstream from start of gene
 
|32 bps downstream from start of gene
|Template Strand
+
|Nontemplate Strand
 
|[[File: TROrange_ethanol_rawdata.xlsx | Raw data ]]
 
|[[File: TROrange_ethanol_rawdata.xlsx | Raw data ]]
 
|-
 
|-
Line 147: Line 147:
 
|adhE
 
|adhE
 
|TACTAAAAAAGTTTAACATTATCA
 
|TACTAAAAAAGTTTAACATTATCA
|locus targeted: -50 upstream (promoter)
+
|locus targeted: -34 upstream (promoter)
 
|Template strand
 
|Template strand
 
|[[File: TRGreen_acetate_rawdata.xlsx | Raw data ]]
 
|[[File: TRGreen_acetate_rawdata.xlsx | Raw data ]]
Line 166: Line 166:
 
|Non-template strand
 
|Non-template strand
 
|[[File: TRPurple_acetate_rawdata.xlsx | Raw data ]]
 
|[[File: TRPurple_acetate_rawdata.xlsx | Raw data ]]
|
 
 
|}
 
|}
  
Line 178: Line 177:
 
|'''Locus targeted (eg. beginning of gene, putative promoter, -35 region)'''
 
|'''Locus targeted (eg. beginning of gene, putative promoter, -35 region)'''
 
|'''Target template or nontemplate strand'''
 
|'''Target template or nontemplate strand'''
 +
|'''Colorimetric Assay Results'''
 
|-
 
|-
 
|WF yellow
 
|WF yellow
Line 183: Line 183:
 
| adhE
 
| adhE
 
| ATTCGAGCAGATGATTTACTAAAAA
 
| ATTCGAGCAGATGATTTACTAAAAA
|
+
| locus targeted: -50 upstream; promoter
|
+
| template strand
 +
|[[File: WFyellow_Acetate_RawData.xlsx | Raw data ]]
 
|-
 
|-
 
|WF green
 
|WF green
Line 190: Line 191:
 
| adhE
 
| adhE
 
| TTACTAAAAAAGTTTAACATTATCA
 
| TTACTAAAAAAGTTTAACATTATCA
|
+
| locus targeted: -35 upstream (promoter)
|
+
| template strand
 +
|[[File: WFGreen_Acetate_RawData.xlsx | Raw data ]]
 
|-
 
|-
 
|WF blue
 
|WF blue
Line 197: Line 199:
 
| adhE
 
| adhE
 
| TTCGAGCAGATGATTTACTAAA
 
| TTCGAGCAGATGATTTACTAAA
| locus targeted: -65 upstream (promoter)
+
| locus targeted: -49 upstream (promoter)
 
| Template Strand  
 
| Template Strand  
 +
|[[File: WFBlue_Acetate_RawData.xlsx | Raw data ]]
 
|}
 
|}
  
Line 241: Line 244:
 
|[[Media:Fa18 WF blue.zip| files]]
 
|[[Media:Fa18 WF blue.zip| files]]
 
|-
 
|-
 +
|}
 +
 +
 +
 +
 +
=Module 3=
 +
 +
===Battery Capacity Raw Data===
 +
[[Media:Fa18_BatteryCapacityRawData.xlsx |Battery Capacity Raw Data]]<br>
 +
 +
===No-gold battery data===
 +
[[Media:Fa18_NoGoldControl.zip|No gold control TEM and EDX images]]<br>
 +
 +
{| border=1px
 +
|'''Experimental battery composition (AuNP/phage)'''
 +
|'''Weight of cathode (mg)'''
 +
|'''Actual capacity (mA*h/g)'''
 +
|-
 +
| 0
 +
| 2.15 mg
 +
| 95.09
 +
|-
 +
| 0
 +
| 2.37 mg
 +
| 89.47
 +
|}
 +
 +
===TR Battery information===
 +
{| border=1px
 +
|'''Team'''
 +
|'''Experimental battery composition (AuNP/phage)'''
 +
|'''Weight of cathode (mg)'''
 +
|'''Actual capacity (mA*h/g)'''
 +
|-
 +
|Red
 +
| 25
 +
| 2.15
 +
| 44.0999
 +
|-
 +
|Orange
 +
|10
 +
|2.87
 +
|20.2247191
 +
|-
 +
|Green
 +
|23
 +
|3.88
 +
|85.67201222
 +
|-
 +
|Pink
 +
|35
 +
|1.55
 +
|29.39068
 +
|-
 +
|Purple
 +
|18
 +
|1.71
 +
|42.12692
 +
|-
 +
|Yellow
 +
|20
 +
|2.2
 +
|21.1
 +
|}
 +
 +
===WF Battery information===
 +
{| border=1px
 +
|'''Team'''
 +
|'''Experimental battery composition (AuNP/phage)'''
 +
|'''Weight of cathode (mg)'''
 +
|'''Actual capacity (mA*h/g)'''
 +
|-
 +
|Yellow
 +
|20
 +
|1.93
 +
|123.296872
 +
|-
 +
|Green
 +
|20
 +
|2.59
 +
|88.94609
 +
|-
 +
|Blue
 +
| 40
 +
| 3.1
 +
| 89.00836
 
|}
 
|}

Latest revision as of 17:43, 7 May 2019

20.109(F18): Laboratory Fundamentals of Biological Engineering

Fa18 20109 banner image.png

Fall 2018 schedule        FYI        Assignments        Homework        Class data        Communication
       1. Measuring genomic instability        2. Modulating metabolism        3. Engineering biomaterials              

Module 1

Cell Loading Data

TR and WF cell loading data

CometChip Data

Team Analyzed Data
T/R red Analyzed CometChip data
T/R orange Analyzed CometChip data
T/R green Analyzed CometChip data
T/R pink Analyzed CometChip data
T/R purple Analyzed CometChip data


Team Analyzed Data
W/F yellow Analyzed CometChip data
W/F green Analyzed CometChip data
W/F blue Analyzed CometChip data
W/F pink Analyzed CometChip data


gamma-H2AX Data

Team Recovery time (min) Raw gamma-H2AX Data Analyzed gamma-H2AX Data
T/R red 30 raw data analyzed data
T/R orange 30 raw data analyzed data
T/R green 30 raw data analyzed data
T/R pink 30 raw data analyzed data
T/R purple 60 raw data analyzed data


Team Recovery time (min) Raw gamma-H2AX Data Analyzed gamma-H2AX Data
W/F yellow 30 raw data analyzed data
W/F green 30 raw data analyzed data
W/F blue 60 raw data analyzed data
W/F pink 30 raw data analyzed data

Module 2

Fermentation product and gene targeted:

T/R

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA (DNA) sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand Colorimetric Assay Results
TR red E pta TGCGCCCGATCAGACTACGACTATC Coding region template File:TRRed ethanol rawdata.xlsx
TR orange E ldhA gttgcaggtacttcttgtcgt 32 bps downstream from start of gene Nontemplate Strand File:TROrange ethanol rawdata.xlsx
TR green A adhE TACTAAAAAAGTTTAACATTATCA locus targeted: -34 upstream (promoter) Template strand File:TRGreen acetate rawdata.xlsx
TR pink A Citrate Synthase (gltA) tgagttttgcttttgtatcagccat Beginning of gene Non-template Strand File:TRPink acetate rawdata.xlsx
TR purple A ldhA TAGTAGCTTAAATGTGATTCAACAT Locus targeted: -40 upstream region (promoter) Non-template strand File:TRPurple acetate rawdata.xlsx

W/F

Team Ethanol (E) or Acetate (A) Gene targeted by CRISPRi gRNA gRNA (DNA) sequence (without tag at 3' end) Locus targeted (eg. beginning of gene, putative promoter, -35 region) Target template or nontemplate strand Colorimetric Assay Results
WF yellow A adhE ATTCGAGCAGATGATTTACTAAAAA locus targeted: -50 upstream; promoter template strand File:WFyellow Acetate RawData.xlsx
WF green Acetate adhE TTACTAAAAAAGTTTAACATTATCA locus targeted: -35 upstream (promoter) template strand File:WFGreen Acetate RawData.xlsx
WF blue A adhE TTCGAGCAGATGATTTACTAAA locus targeted: -49 upstream (promoter) Template Strand File:WFBlue Acetate RawData.xlsx

gRNA_target Sequencing Results

T/R

Team pgRNA sequencing
red files
orange files
green files
pink files
purple files

W/F

Team pgRNA sequencing
yellow files
green files
blue files



Module 3

Battery Capacity Raw Data

Battery Capacity Raw Data

No-gold battery data

No gold control TEM and EDX images

Experimental battery composition (AuNP/phage) Weight of cathode (mg) Actual capacity (mA*h/g)
0 2.15 mg 95.09
0 2.37 mg 89.47

TR Battery information

Team Experimental battery composition (AuNP/phage) Weight of cathode (mg) Actual capacity (mA*h/g)
Red 25 2.15 44.0999
Orange 10 2.87 20.2247191
Green 23 3.88 85.67201222
Pink 35 1.55 29.39068
Purple 18 1.71 42.12692
Yellow 20 2.2 21.1

WF Battery information

Team Experimental battery composition (AuNP/phage) Weight of cathode (mg) Actual capacity (mA*h/g)
Yellow 20 1.93 123.296872
Green 20 2.59 88.94609
Blue 40 3.1 89.00836