Difference between revisions of "20.109(F18):Class data"
From Course Wiki
Alli Huske (Talk | contribs) (→WF Battery information) |
(→WF Battery information) |
||
| Line 312: | Line 312: | ||
|- | |- | ||
|Yellow | |Yellow | ||
| − | | | + | |20 |
| − | | | + | |1.96 |
| − | | | + | |121.41 |
|- | |- | ||
|Green | |Green | ||
Revision as of 20:21, 5 December 2018
Contents
Module 1
Cell Loading Data
CometChip Data
| Team | Analyzed Data |
| T/R red | Analyzed CometChip data |
| T/R orange | Analyzed CometChip data |
| T/R green | Analyzed CometChip data |
| T/R pink | Analyzed CometChip data |
| T/R purple | Analyzed CometChip data |
| Team | Analyzed Data |
| W/F yellow | Analyzed CometChip data |
| W/F green | Analyzed CometChip data |
| W/F blue | Analyzed CometChip data |
| W/F pink | Analyzed CometChip data |
gamma-H2AX Data
| Team | Recovery time (min) | Raw gamma-H2AX Data | Analyzed gamma-H2AX Data |
| T/R red | 30 | raw data | analyzed data |
| T/R orange | 30 | raw data | analyzed data |
| T/R green | 30 | raw data | analyzed data |
| T/R pink | 30 | raw data | analyzed data |
| T/R purple | 60 | raw data | analyzed data |
| Team | Recovery time (min) | Raw gamma-H2AX Data | Analyzed gamma-H2AX Data |
| W/F yellow | 30 | raw data | analyzed data |
| W/F green | 30 | raw data | analyzed data |
| W/F blue | 60 | raw data | analyzed data |
| W/F pink | 30 | raw data | analyzed data |
Module 2
Fermentation product and gene targeted:
T/R
| Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
| TR red | E | pta | TGCGCCCGATCAGACTACGACTATC | Coding region | template | File:TRRed ethanol rawdata.xlsx |
| TR orange | E | ldhA | gttgcaggtacttcttgtcgt | 32 bps downstream from start of gene | Nontemplate Strand | File:TROrange ethanol rawdata.xlsx |
| TR green | A | adhE | TACTAAAAAAGTTTAACATTATCA | locus targeted: -34 upstream (promoter) | Template strand | File:TRGreen acetate rawdata.xlsx |
| TR pink | A | Citrate Synthase (gltA) | tgagttttgcttttgtatcagccat | Beginning of gene | Non-template Strand | File:TRPink acetate rawdata.xlsx |
| TR purple | A | ldhA | TAGTAGCTTAAATGTGATTCAACAT | Locus targeted: -40 upstream region (promoter) | Non-template strand | File:TRPurple acetate rawdata.xlsx |
W/F
| Team | Ethanol (E) or Acetate (A) | Gene targeted by CRISPRi gRNA | gRNA (DNA) sequence (without tag at 3' end) | Locus targeted (eg. beginning of gene, putative promoter, -35 region) | Target template or nontemplate strand | Colorimetric Assay Results |
| WF yellow | A | adhE | ATTCGAGCAGATGATTTACTAAAAA | locus targeted: -50 upstream; promoter | template strand | File:WFyellow Acetate RawData.xlsx |
| WF green | Acetate | adhE | TTACTAAAAAAGTTTAACATTATCA | locus targeted: -35 upstream (promoter) | template strand | File:WFGreen Acetate RawData.xlsx |
| WF blue | A | adhE | TTCGAGCAGATGATTTACTAAA | locus targeted: -49 upstream (promoter) | Template Strand | File:WFBlue Acetate RawData.xlsx |
gRNA_target Sequencing Results
T/R
| Team | pgRNA sequencing |
| red | files |
| orange | files |
| green | files |
| pink | files |
| purple | files |
W/F
| Team | pgRNA sequencing |
| yellow | files |
| green | files |
| blue | files |
Module 3
Battery Capacity Raw Data
No-gold battery data
No gold control TEM and EDX images
| Experimental battery composition (AuNP/phage) | Weight of cathode (mg) | Actual capacity (mA*h/g) |
| 0 | 2.15 mg | 95.09 |
| 0 | 2.37 mg | 89.47 |
TR Battery information
| Team | Experimental battery composition (AuNP/phage) | Weight of cathode (mg) | Actual capacity (mA*h/g) |
| Red | 25 | 2.15 | 44.0999 |
| Orange | 10 | 2.87 | 20.2247191 |
| Green | 23 | 3.88 | 85.67201222 |
| Pink | 35 | 1.55 | 29.39068 |
| Purple | 18 | 1.71 | 42.12692 |
WF Battery information
| Team | Experimental battery composition (AuNP/phage) | Weight of cathode (mg) | Actual capacity (mA*h/g) |
| Yellow | 20 | 1.96 | 121.41 |
| Green | 20 | 2.59 | 88.94609 |
| Blue | 40 | 3.1 | 89.00836 |
